• "Spreading the ideas of freedom loving people on matters regarding metals, finance, politics, government and many other topics"

Corona Virus News & Info

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,948
Reaction score
30,679
Dr. Robert Malone was injured by the COVID-19 vaccine. Here's his story.

"How Bad is my Batch"
The story of my vaccine injury​
Robert W Malone MD, MS -- Jan 13, 2022​

RM220113.jpg


The Vax Lot saga continues...
 

Goldhedge

Retired
Sr Midas Sup +++
Survivor
GIM Hall Of Fame
Joined
Mar 28, 2010
Messages
70,133
Reaction score
155,292
Location
Rocky Mountains
Far ahead of the curve...

Screen Shot 2022-01-13 at 11.28.15 AM.png
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,948
Reaction score
30,679

Ensoniq

Midas Member
Midas Member
Eagle
Joined
Apr 9, 2013
Messages
13,059
Reaction score
30,101
Location
North Carolina
View attachment 240708

The Vax Lot saga continues...

So the whole idea that most of the deaths come from a few lots is fake news

Pretty equal distribution of death across all lots and an enormous sample size
 

Ensoniq

Midas Member
Midas Member
Eagle
Joined
Apr 9, 2013
Messages
13,059
Reaction score
30,101
Location
North Carolina

Joe King

Midas Member
Midas Member
Sr Site Supporter
Joined
Mar 31, 2010
Messages
12,704
Reaction score
16,912
Location
Instant Gratification Land
So the whole idea that most of the deaths come from a few lots is fake news

Pretty equal distribution of death across all lots and an enormous sample size
That's a good thing. Proves all of it ain't worth nothin'
 

TRYNEIN

Gold Member
Gold Chaser
Site Supporter ++
Joined
Sep 16, 2012
Messages
17,472
Reaction score
101,083
Location
third cove on the right
e387e2d9638a0c19.jpg
 

TRYNEIN

Gold Member
Gold Chaser
Site Supporter ++
Joined
Sep 16, 2012
Messages
17,472
Reaction score
101,083
Location
third cove on the right

the_shootist

Checked out! Good luck!
Eagle
Mother Lode
Joined
May 31, 2015
Messages
81,156
Reaction score
181,612
"Fauci explains how he introduced AIDS, back in '84 ..."

https://www.bitchute.com/video/Rve6CPneJBo3/
WOW, this is the first time I've seen this clip. I'm bowled over by the reckless candor he seemed to display in making those statements. Could this possible been taken out of context? He's pretty much saying what you stated...that 'he' introduced AIDS as a biological agent into the populous.

Man, the torches, pitchforks and ropes will be coming out sooner than I thought they might once this gets legs out there
 

TRYNEIN

Gold Member
Gold Chaser
Site Supporter ++
Joined
Sep 16, 2012
Messages
17,472
Reaction score
101,083
Location
third cove on the right
WOW, this is the first time I've seen this clip. I'm bowled over by the reckless candor he seemed to display in making those statements. Could this possible been taken out of context? He's pretty much saying what you stated...that 'he' introduced AIDS as a biological agent into the populous.

Man, the torches, pitchforks and ropes will be coming out sooner than I thought they might once this gets legs out there


Make sure to help spread it around...

They won't be able to walk down the street!!!
 

dacrunch

Midas Member
Midas Member
Joined
Apr 9, 2010
Messages
10,718
Reaction score
17,261

Nomis Elpmis

Minimalist
Silver Miner
Joined
Apr 2, 2010
Messages
552
Reaction score
520
This video clip is taken out of context and therefore is unpersuasive of your claim.
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,948
Reaction score
30,679
This could be "construed" as "taken out of context"... by the "naysayers" and so-called "fact-checkers"... I KNOW that's what my daughter will reply...
I agree it was taken out of context.
A better indictment of Tony Fauci is Robert F. Kennedy, Jr's book The Real Anthony Fauci. If people would read that, they would see the evil that little man has been up to for decades.
 

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452
I believe this to be accurate.

1642207346071.jpeg
 

Casey Jones

Train left the station...
Gold Chaser
Site Supporter ++
Platinum Bling
Joined
Apr 4, 2020
Messages
10,158
Reaction score
16,494
Location
Down the road from the Kaczynski ranch
This could be "construed" as "taken out of context"... by the "naysayers" and so-called "fact-checkers"... I KNOW that's what my daughter will reply...
That's what I thought, too.

"Introduced into the community" could easily mean, an HIV-infected promiscuous homosexual comes into the area for the first time. Or someone who's from the area, travels, buggers an infected person in another area, contracts it, and takes it home to spread the joy.

There's a lot out there to hang Fouch-chee with; but I don't think this is going to be part of it.

Agreed, though, Fouch was deep in the seemingly-deliberate mishandling of AIDS. The spread could have been stopped, and fast...and I have to wonder, had ivermectin been around then, if it could have been beaten back in early stages.
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,948
Reaction score
30,679
Agreed, though, Fouch was deep in the seemingly-deliberate mishandling of AIDS. The spread could have been stopped, and fast...and I have to wonder, had ivermectin been around then, if it could have been beaten back in early stages.

I don't know how Ivermectin would affect HIV but to your point, Ivermectin was around back then:

1642212810666.png


It may be that it was ignored like now because friends in big pharma had other drugs that would make millions of dollars more.

Screw Tony Fauci.
 

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452
1642213629829.png
 

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452

Life insurer refuses to cover vaccine death​

An explosive case is currently being hotly debated on social media: In France, a rich, older entrepreneur from Paris is said to have died as a result of a Corona injection. Previously, he had taken out multi-million dollar life insurance policies for the benefit of his children and grandchildren, according to a media report.

Published: January 14, 2022, 12:30 pm

Although vaccination is recognized as the cause of death by doctors and the insurance company, it has refused to pay out. The reason is because the side effects of the Corona jabs are known and published. They argue that the deceased took part in an experiment at his own risk. Covid-19 in itself is not classed as a “critical illness”.

According to the company, an experimental vaccination resulting in death is like suicide​

The insurance company justified the refusal of payment to the family by stating that the use of experimental medication or treatments, including Corona injections, is expressly excluded from the insurance contract. The family’s subsequent lawsuit against the insurance company has been unsuccessful.
The court allegedly justified its ruling as follows: “The side effects of the experimental vaccine are published and the deceased could not claim to have known nothing about it when he voluntarily took the vaccine. There is no law or mandate in France that compelled him to be vaccinated. Hence his death is essentially suicide.” Since suicide is not covered by the policy from the outset, the insurance refuses to budge.

Scandalous verdict: taking a fatal risk is legally suicide​

“The court recognizes the classification of the insurer who, in view of the announced side effects, including death, legally regards participation in the phase three experiment, whose proven harmlessness is not given, as voluntarily taking a fatal risk that is not covered by the contract and legally recognized as suicide. The family has appealed. However, the insurer’s defense is recognized as well-founded and contractually justified, as this publicly known fatal risk is legally considered suicide, since the customer has been notified and has agreed to voluntarily take the risk of death without being obliged or compelled to do so.”

No surprise: Mainstream media is silent​

This case has not yet been reported in France ‘s mainstream media. The case was published by the family’s lawyer, Carlo Alberto Brusa, on social media. Unfortunately, no sources or court records are given, which is why the authenticity of the report cannot currently be verified although there have been other warnings regarding the risk associated with the jabs recognized by insurers. In the US, the American Council of Life Insurers (ACLI) has denied reports of non-payment.

Censorship​

In recent months, many French anti-vaccine groups of the social network Facebook have been victims of sudden, unjustified closures, especially support groups for Brusa and Professor Didier Raoult. The latter has often been criticized for his positions on vaccines, hydroxychloroquine and his criticism of the mismanagement of the epidemic by the Macron government.
At the end of last year, the main support group for Didier Raoult was deactivated before it was reactivated, thanks to a mobilization on social networks and a massive relay on alternative media. On November 27, a teacher support group for Brusa was suspended. With no less than 310 000 members to its credit, the group created in March 2020 was closed for having shared the complaint by Brusa concerning the wearing of masks for children. The Parisian lawyer and his association Réaction-19 was accused of spreading a “conspiracy”.

Global difficulties for insurers due to vaccines​

Actuaries have been warning that rising claims will be eroding the capital which insurers set aside to avoid insolvency. Notably, older people do not take out life insurance, which means that the claims have been from younger clients. Insurers say that they expect a rise in excess deaths.
According to Alex Berenson, the risk of injury or death from the jab is exceptionally high judging from Canadian data.
The refusal to pay for a vaccine-related death may not be surprising since globally the life insurance industry has been hit with reported claims of $5,5 billion in the first nine months of 2021 versus $3,5 billion for the whole of 2020, according to insurance broker Howden.
Dutch insurer Aegon, with two-thirds of its business in the US, said its American claims in the third quarter were $111 million, up from $31 million a year earlier.
Vaccine deaths may force insurers to raise premiums and some have indicated that they intend to punish the unvaccinated for their financial woes.
 

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452
GO TO THIS SITE!


The OpenVAERS Project​



VAERS is the Vaccine Adverse Event Reporting System put in place in 1990. It is a voluntary reporting system that has been estimated to account for only 1% ( see the Lazarus Report) of vaccine injuries. OpenVAERS is built from the HHS data available for download at vaers.hhs.gov.

The OpenVAERS Project allows browsing and searching of the reports without the need to compose an advanced search (more advanced searches can be done at medalerts.org or vaers.hhs.gov). To start searching OpenVAERS, please use the red button below.

Reports are current through December 31, 2021.

search VAERS reports 12 72 132 192 252 312 reset...
Page 1 of 187698 Results 1 - 10 of 1876973
 

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452

TRYNEIN

Gold Member
Gold Chaser
Site Supporter ++
Joined
Sep 16, 2012
Messages
17,472
Reaction score
101,083
Location
third cove on the right
Someone may have just blown Moderna up. Others have previously identified non naturally occurring genetic sequences ... Appears one of the human fingerprints inexplicably appears in a Moderna patent filing. I have still never heard Fauci or anyone explain - if not the case - where's the bat?!?! There is/was none.




Amk5wuOtFWxT.jpeg
 

Ensoniq

Midas Member
Midas Member
Eagle
Joined
Apr 9, 2013
Messages
13,059
Reaction score
30,101
Location
North Carolina
He’s like a kid with a chemistry set just mixing th8ngs together to see what happens. The whole morality of respect for human life doesn’t seem to be present in psychopaths
 

Joe King

Midas Member
Midas Member
Sr Site Supporter
Joined
Mar 31, 2010
Messages
12,704
Reaction score
16,912
Location
Instant Gratification Land

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452
I thought he meant those that funded the "research" as in fauci.
 

engineear

Platinum Bling
Midas Supporter
Platinum Bling
Joined
Mar 11, 2011
Messages
5,986
Reaction score
9,755
Location
North of the Wall
Someone may have just blown Moderna up. Others have previously identified non naturally occurring genetic sequences ... Appears one of the human fingerprints inexplicably appears in a Moderna patent filing. I have still never heard Fauci or anyone explain - if not the case - where's the bat?!?! There is/was none.




Amk5wuOtFWxT.jpeg
Those bats were scientists working at Wuhan.
 

Winston_Room101

Silver Miner
Joined
Mar 31, 2010
Messages
599
Reaction score
538
@ CTCCTCGGCGGGCACGTAG
from
is

"
https%3A%2F%2Fbucketeer-e05bbc84-baa3-437e-9518-adb32be77984.s3.amazonaws.com%2Fpublic%2Fimages%2F8f7cb4d1-54b4-481c-b4e9-5011c9f28a95_758x313.png
"

In this particular section you can see it’s a sequence of the “spike protein” (surface glycoprotein) and the nucleotides are labelled 23548…23771 (of about 30,000 nucleotides or bases i.e. G-C-A-T). [NB: in actual fact this is RNA so should have a U in place of every T, but BLAST compensates for this automatically for simplicity]. The smaller number is the number of amino acid in the protein sequence so for each 3 nucleotides, the number goes up by 1 amino acid. The highlight is amino acid 677 (Q) to 686 (S), giving 677→686 = QTNSPRRARS.
Now, this is really interesting because not only have we seen that the QTNS section is derived from HIV but there is something very special about the adjacent PRRAR because that is a furin cleavage site and as we have seen, these don’t exist in this type of SARS-like virus. It’s an insertion to the viral genome, but nobody really knows how it got there (just like the HIV sequences). In order to see where it came from we need to look outside the amino acid sequence and back to the genome sequence.
The genome sequence that you can see for this amino acid sequence is: CAGACTAATTCTCCTCGGCGGGCACGTAGT which is 30 nucleotides coding for 10 amino acids. For this sequence to arise by chance would be an infinitesimally small number, so it has to have arisen somewhere (i.e. from another virus) or else some of it must be synthetic. So let’s BLAST(n) it, and this time we exclude “synthetic constructs” from our search (because we are looking for real viruses, not synthetic ones). What do we get?

and from the comments
Sky Savage
Dec 28, 2021Liked by Dr Ah Kahn Syed
This work should be the subject of a real congressional hearing. The data are damn near irrefutable. As a scientist, I am continually astounded that more scientists are not speaking up about this.

24
Reply


founding
Dr Ah Kahn Syed
Dec 28, 2021
AUTHOR
Correct. The fact that as a PhD I have to hide behind a murine avatar and pseudonym should tell you all you need to know.

24
Reply

and then
ModeRnaTx

Synthetic construct HCV1146 Moderna (mRNA-1273) SARS-CoV-2 vaccine sequence​


JOURNAL Submitted (10-SEP-2021) Department of Clinical Microbiology,
Copenhagen University Hospital Amager-Hvidovre, University of
Copenhagen, Kettegaard Alle 30, Hvidovre 2650, Danmark
REFERENCE 1 (bases 1 to 3828)

3828 / 3 = 1276
 

Joe King

Midas Member
Midas Member
Sr Site Supporter
Joined
Mar 31, 2010
Messages
12,704
Reaction score
16,912
Location
Instant Gratification Land
^^^^ imho, everyone should read that link. Spells it out pretty clearly.
 

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452

Hulk Hogan Slams COVID Narrative, Claims Vaccinated Are “Dropping Like Flies”​

byJill Schrider
January 15, 2022
2 minute read
The Hulkimaniac has come out swinging against the experimental COVID injection, claiming the vaccinated are “dropping like flies” while referring to popular celebrities who have recently passed away.
Screen-Shot-2022-01-14-at-8.54.39-PM-658x1024.png

This isn’t the first time Hulkimania has taken the COVID-craze head-on. Back in 2020, Hogan posted a long-form response to the COVID-inspired government lockdowns where he invoked the name, Jesus Christ.
“Maybe we don’t need a vaccine,” Hogan writes. “Maybe we need to take this time of isolation from the distractions of the world and have a personal revival where we focus on the ONLY thing in the world that really matters. Jesus.”

“Word up, can you handle the truth my brother only love HH In three short months, just like He did with the plagues of Egypt, God has taken away everything we worship. God said, “you want to worship athletes, I will shut down the stadiums. You want to worship musicians, I will shut down Civic Centers. You want to worship actors, I will shut down theaters. You want to worship money, I will shut down the economy and collapse the stock market. You don’t want to go to church and worship Me, I will make it where you can’t go to church”
“If my people who are called by my name will humble themselves and pray and seek my face and turn from their wicked ways, then I will hear from heaven and will forgive their sin and will heal their land.”
Hulk Hogon has since been the target of liberal media outlets and talk show hosts who have all come out against his opinions on the vaccine. This, of course, has had little effect on the 5 times world wrestling champion, as his unwavering love of God keeps the Hulkamaniac in good spirits.

Hulk Hogan is an inspiration and a role model for all, and an exemplary American. The brutish giant has a heart bigger than any politician in the white house, and he isn’t about to let a vaccine stop it.
 

arminius

Argentate Bluster
Eagle
Platinum Bling
Joined
Jun 6, 2011
Messages
7,878
Reaction score
13,327
@ CTCCTCGGCGGGCACGTAG
from
is

So this BLAST is a manufactored poison, not a virus, therefore not infective or spread the way some of ya'all believe viruses are spread. Good thing we have lots of movies to teach us, right.

So therefore what's the easiest way to spread this, and how in the past have poisons been spread to damage populations. Water mainly, but in the last 100 years, secondary to airplanes, air.
 

Casey Jones

Train left the station...
Gold Chaser
Site Supporter ++
Platinum Bling
Joined
Apr 4, 2020
Messages
10,158
Reaction score
16,494
Location
Down the road from the Kaczynski ranch
So this BLAST is a manufactored poison, not a virus, therefore not infective or spread the way some of ya'all believe viruses are spread. Good thing we have lots of movies to teach us, right.

So therefore what's the easiest way to spread this, and how in the past have poisons been spread to damage populations. Water mainly, but in the last 100 years, secondary to airplanes, air.
It didn't occur in nature; so the odds are, it won't survive long in nature. mOronic Variant may be proof of that...as the virus mutates to something more amenable to what environment that successful viruses live in.

But meantime...we've got a veritable army of Doctor-Frankenstein wannabees out there...here and in Wuhan. All excited about making you sick and keeping you sicker.
 

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452

Florida won’t enforce federal health care worker vaccine mandate​

Where does that leave the state’s hospitals and nursing homes?
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,948
Reaction score
30,679
test
@ CTCCTCGGCGGGCACGTAG
from
is

"
https%3A%2F%2Fbucketeer-e05bbc84-baa3-437e-9518-adb32be77984.s3.amazonaws.com%2Fpublic%2Fimages%2F8f7cb4d1-54b4-481c-b4e9-5011c9f28a95_758x313.png
"





and from the comments


and then
ModeRnaTx

Synthetic construct HCV1146 Moderna (mRNA-1273) SARS-CoV-2 vaccine sequence​





3828 / 3 = 1276

Interesting reader comments also.....

BLAST.jpg
 

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452

POLITICAL Science: HHS Tells Hospitals to Stop Reporting Covid Deaths Ahead of Midterms​

By J.D. Rucker • Jan. 15, 2022

The plummeting fortunes of the Democrat Party have rendered many progressives apoplectic. They don’t understand why the Biden-Harris regime policies aren’t working or why the Democrat majority on Capitol Hill can’t get anything passed. They see their polling numbers and most are beside themselves, masked and terrified of what’s to come.
But some are still fighting. When backed into a corner, Democrats have a tendency to go to extremes to try to maintain power. The latest move by Health and Human Services appears to be the opening volley in a desperate move to salvage the fortunes of the party ahead of the midterm elections.


It’s no coincidence that the documents telling hospitals to stop reporting Covid-19 deaths were dropped on January 6 when many Americans were busy debunking the wild claims of the left that it was an anniversary of an “insurrection” while a few Americans were getting their daily fix of confirmation bias on CNN or MSNBC. Either way, the news was buried while media was busy covering the non-story of the January 6 mostly peaceful protests.


This was by design.

But some people noticed, and now we’re here to make sure more people know about it. Despite the incessant demands by the regime that every man, woman, and child gets vaccinated to “save lives,” they’re taking the opposite approach with recording the numbers. By telling hospitals not to report deaths, their intention is to make a steady drop in Covid statistics that will artificially point to the regime’s “successful” efforts against the pandemic.


It’s all a lie, of course, but did we expect anything less from a regime that claimed the Afghanistan withdrawal was a success and that we’re in the middle of the greatest economy in world history?
 

Ensoniq

Midas Member
Midas Member
Eagle
Joined
Apr 9, 2013
Messages
13,059
Reaction score
30,101
Location
North Carolina

Florida won’t enforce federal health care worker vaccine mandate​

Where does that leave the state’s hospitals and nursing homes?

i see no conflict. As I understand it Florida is not preventing hospitals from following the rule, they just won’t use state resources to enforce Fed rules. Plenty of precedent that the Feds can’t compel states to help them
 

Casey Jones

Train left the station...
Gold Chaser
Site Supporter ++
Platinum Bling
Joined
Apr 4, 2020
Messages
10,158
Reaction score
16,494
Location
Down the road from the Kaczynski ranch

Florida won’t enforce federal health care worker vaccine mandate​

Where does that leave the state’s hospitals and nursing homes?
Probably FedGov will refuse Medicare/Medicaid payments to them.

That's the kind of confrontation that Biden's handlers just LUUUV.
 

RebelYell

Name no longer reflects my changed worldview.
Joined
Apr 2, 2010
Messages
1,740
Reaction score
2,437

We'll See​

================​

Gates, Fauci, and Daszak charged with Genocide in Court Filing​


In a stunning 46-page legal filing to the International Criminal Court on December 6, an intrepid attorney and seven applicants accused Anthony Fauci, Peter Daszak, Melinda Gates, William Gates III, and twelve others of numerous violations of the Nuremberg Code. These included various crimes against humanity and war crimes as defined by the Rome Statutes, Articles 6, 7, 8, 15, 21, and 53.

https://www.riotimesonline.com/braz...ty-in-international-criminal-court-complaint/


https://dailyexpose.uk/2021/12/10/u...-international-criminal-court/comment-page-1/


https://leohohmann.com/2021/12/17/w...-committed-crimes-against-humanity/#more-8418

Besides the four kingpins, twelve others were named, including the CEOs of the leading vaccine corporations and the health leaders held accountable for the United Kingdom.

  • Albert Bourla, CEO of Pfizer
  • Stephane Bancel, CEO of AstraZeneca
  • Pascal Soriot, CEO of Moderna
  • Alex Gorsky, CEO of Johnson and Johnson
  • Tedros Adhanhom Ghebreyesus, Director-General of the WHO
  • Boris Johnson, UK Prime Minister
  • Christopher Whitty, UK Chief Medical Adviser
  • Matthew Hancock, former UK Secretary of State for Health and Social Care
  • Sajid Javid, current UK Secretary of State for Health and Social Care
  • June Raine, UK Chief Executive of Medicines and Healthcare products
  • Dr. Ravid Shah, President of the Rockefeller Foundation
  • Klaus Schwab, President of the World Economic Forum
https://docdro.id/WUjv6iw

Dr. Ravid Shah, having worked for the Gates Foundation since 2001, was named a World Economic Forum “Young Global Leader” in 2007. He now presides over the Rockefeller Foundation, a group funding ID2020 along with the Gates Foundation.

https://norberthaering.de/en/power-control/id2020-immunization-passes/


Klaus Schwab, a wickedly intelligent, perhaps diabolical German with double doctorate degrees in Economics and Engineering, is the founder of the World Economic Forum, a club for the wealthiest percentile of the world’s corporate and political elite. He is a power broker who has groomed many presidents, prime ministers, and tech CEOs who now view him with reverence and unswerving loyalty.

Schwab, an economist, and technocrat has befriended many nations, most significantly China’s Xi Jinping, who delivered a key speech at Davos. He praised his vision of a New World Order. On January 25, 2021, Klaus Schwab vowed his support for Xi Jinping with these words, “Mr. President (Xi Jinping) I believe this is the best time to reset our policies and to work, jointly, for a peaceful and prosperous world. We all welcome now, his excellency, Xi Jinping, President of the People’s Republic of China.” See mark 2:26.


View attachment 237794
61c0bd0b560eb.image.png


Many consider Schwab the mastermind behind the current movement towards cryptocurrency, universal identification, and a one-world (fascist) government to be run jointly, in totalitarian fashion, with China.

https://conservapedia.com/Klaus_Schwab

Attorney Hannah Rose and seven applicants brought the Nuremberg action on behalf of the victims, the entire population of the United Kingdom. She filed the legal proceeding with the International Criminal Court located at The Hague. The Hague is notable for its long history in helping victims seek redress for war crimes and defining appropriate ethical guidelines for conduct during war.

Following the Nazi atrocities committed during World War II, the war crime trials were held in Nuremberg, Germany. Following these, a set of principles was developed, which ultimately led to the development of the Nuremberg Code.

These principles essentially meant that anyone, no matter how wealthy or powerful, even a head of state, was not above the law. The fact that the law of their home nation would permit their action would not relieve the person from justice under international law.

In particular, the medical experiments conducted by the Nazi doctors led to strict rules and ethical principles regarding future human scientific trials, including the doctrine of necessary informed consent and freedom from coercion or threat in submitting to experimental drugs.

As we all know, before receiving a surgical procedure, there is a legal and ethical requirement that the patient be apprised of any significant potential risks, including infection, bleeding, nerve damage, or even death. The patient usually signs the consent form following this explanation. And as we all know, whenever we receive prescription medication, we are notified of the potential risks on a package insert and usually a discussion with the Pharmacist.


The vaccines should be no different, yet they are. A person about to receive the jab is rarely told that there are risks of blood clots, bleeding, cerebral thrombosis, myocarditis, and death, yet those risks exist. See mark 12:58 to 17:40.

https://rumble.com/vg6dcd-peter-mccullough-interview.html

https://ukfreedomproject.org/resources/open-letter-to-dr-june-raine-chief-executive-mhra/

https://www.thedesertreview.com/opi...cle_b1089af2-4279-11ec-b491-5bcaf600d33c.html

https://www.totalhealth.co.uk/blog/are-people-getting-full-facts-covid-vaccine-risks

Attorney Hannah Rose notes in Point 40 of her brief that the ethical standards of the Nuremberg Code amount to an obligation on physicians and pharmaceutical manufacturers to abide by its principles. Accordingly, any physician or research scientist found to have breached any of the ten principles of the Nuremberg Code would face criminal liability.

https://docdro.id/WUjv6iw

She notes in Point 42, “The first principle of the Nuremberg Code is a willingness and informed consent by the person to receive treatment and participate in an experiment. The person is supposed to activate freedom of choice without the intervention, either through force, deceit, fraud, threat, solicitation, or any other type of binding or coercion.”

https://docdro.id/WUjv6iw

In Point 43 she argues, “When the heads of the Ministry of Health as well as the Prime Minister presented the vaccine in the United Kingdom and began the vaccination of United Kingdom residents, the vaccinated were not advised, that in practice, they would be taking part in a medical experiment and that their consent is required under the Nuremberg Code. This as a matter of fact is a genetic medical experiment on human beings performed without informed consent under a severe and blatant offense of the Nuremberg Code.”


In addition, Rose argues under Point 44 that there is an obligation for alternative treatments to be discussed, including the risks and benefits of such alternatives. She notes that these were never discussed despite the fact alternative treatments have been proven to be safe and effective “with up to a 100% success rate.”

https://docdro.id/WUjv6iw

https://www.zerohedge.com/covid-19/indias-ivermectin-blackout-secret-revealed

A key principle of the Nuremberg Code requires that a scientist must be prepared to terminate the experiment at any stage, if he has probable cause to believe, in the exercise of the good faith, superior skill, and careful judgment required of him that a continuation of the experiment is likely to result in injury, disability, or death to the experimental subject.

https://encyclopedia.ushmm.org/cont...emberg-code#permissible-medical-experiments-1

In Point 46, she argues, “It is known that the mRNA ‘vaccination’ treatments have caused the death of many as well as injury and severe damage (including disablement and paralysis) after the ‘vaccine’ was administered. Despite this fact, the government did not instruct the initiation of an investigation into the matter. It is also questionable that given the experimental nature of these vaccinations, that there are not any full reports available of the numbers of dead or injured, as may be expected in such a medical process for the benefit of the public participating in the experiment.”

https://docdro.id/WUjv6iw

The reader is reminded that Nazi physicians conducted experiments on human beings in concentration camps without informed consent, leading to horrific suffering and death.


https://encyclopedia.ushmm.org/content/en/article/nazi-medical-experiments

https://www.pbs.org/wgbh/nova/holocaust/experiside.html

To dramatically underscore the relevance of Nuremberg to the horrific deaths we now see related to the experimental mRNA ‘vaccination’ program, Rose, in Point 34a, included a statement from a group of Holocaust survivors, those who experienced first-hand both the Nazi experiments and today the vaccine experiment. This is an excerpt from their unique perspective:

We, the survivors of the atrocities committed against humanity during the Second World War, feel bound to follow our conscience…Another holocaust of greater magnitude is taking place before our eyes. We call upon you to stop this ungodly medical experiment on humankind immediately. It is a medical experiment to which the Nuremberg Code must be applied.

https://docdro.id/WUjv6iw

Holocaust survivor Vera Sharav issued a statement in Points 34b and 34c:

The stark lesson of the Holocaust is that whenever doctors join forces with government and deviate from their personal, professional, clinical commitment to do no harm to the individual, medicine can then be perverted from a healing, humanitarian profession to a murderous apparatus…What sets the Holocaust apart from all other mass genocides is the pivotal role played by the medical establishment, the entire medical establishment. Every step of the murderous process was endorsed by the academic, professional medical establishment.

https://docdro.id/WUjv6iw

As a direct result of the Nuremberg World War II experience, the United Nations asked the International Law Commission to develop the Nuremberg Principles, the key standards to avoid the Nazi doctors' atrocities. Unfortunately, as Hannah Rose pointed out, many of these ten principles of the Nuremberg Code were systematically violated by the United Kingdom and many other countries during the COVID-19 pandemic.


https://encyclopedia.ushmm.org/cont...emberg-code#permissible-medical-experiments-1

View attachment 237795
61c0bded2c43e.image.png

International Criminal Court
In addition, a permanent international criminal court was established for investigation and enforcement - known as The International Criminal Court. The ICC began full-time operations in 2002 and currently has 123 member nations that have explicitly agreed to be bound by the Rome Statutes.

The United Kingdom is a member while the United States is not. However, under article 12(3) of the Rome Statute of the International Criminal Court, even a state that is NOT a member may exercise jurisdiction "by declaration lodged with the Registrar," meaning that any nation may be subject to the ICC depending upon the circumstances, member nation or not. Keep in mind that Nazi Germany had not consented to jurisdiction.

The ICC bills itself as a "court of last resort" meaning that claims should be decided in the perpetrator's home nation whenever possible. However, the core principle of impunity drives the ICC, the belief that no one who commits war crimes should enjoy freedom from criminal responsibility. Therefore, the ICC operates as an impartial and omnipotent arbiter of world human rights and will aggressively step in when it sees flagrant Nuremberg-type atrocities without consequence.

That is precisely what Hannah Rose has identified in her legal brief in Point 2,

"We have tried to raise this case through the English police and the English Court system without success, we have been unable even to get the case registered either with the police or with the court after several attempts...This is such a case which is why we are addressing the ICC directly."


Attorney Rose relied partly upon the expertise of Dr. Michael Yeadon, a research-based PhD in respiratory pharmacology and former Vice President and Chief Scientist at Pfizer.

https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

In the background section of the brief, she writes in Point 5:

"The Covid-19 ‘vaccines’ do not meet the requirement to be categorized as vaccines and are in fact gene therapy (Appendix 8)...Dr. Mike Yeadon, a joint applicant on this request, asserts that claims calling the Covid-19 injections a 'vaccine' is public manipulation and misrepresentation of clinical treatment.

It's not a vaccination. It's not prohibiting infection. It's not a prohibiting transmission device. It's a means by which your body is conscripted to make the toxin that then allegedly your body somehow gets used to dealing with it, but unlike a vaccine, which is to trigger the immune response, this is to trigger the creation of the toxin.'

MRNA uses the cell's machinery to synthesize proteins that are supposed to resemble the SPIKE protein of the virus, which is what it uses to enter cells via the ACE2 receptor. These proteins are then identified by the immune system, which builds antibodies against them. The real concern is that these proteins could accumulate in the body, especially in regions of high concentration of ACE2 receptors, such as the gonads. If the immune system then attacks the location where they accumulate, then you could be dealing with an auto-immune condition."

https://docdro.id/WUjv6iw

Dr. Yeadon mentions, in an interview, that our governments have grossly exaggerated the entire threat of COVID-19. He notes that COVID-19 represents a slightly greater risk than influenza if you are older than age 70 but a much lower risk than the seasonal flu if you are younger. See mark 31:00.


https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

"So it’s just absurd that you should be happy or willing to let your economy and civil society be smashed for something which represents for almost everyone working a lower risk than influenza - but that’s true.

Given this virus represents at worst a slightly bigger risk to the old and ill than does influenza, and a less risk than for almost everyone else who’s younger and fit, it was NEVER NECESSARY for us to have done anything.

We didn't need to do anything, lockdowns, masks, mass testing, vaccines - there are multiple therapeutic drugs that are at least as effective as vaccines are...an off-patent drug called Ivermectin, one of the most widely used drugs in the world, is also able to reduce symptoms at any stage of the disease including lethality by about 90%.

https://www.amazon.com/Ivermectin-Freedom-Justus-R-Hope-ebook/dp/B09M95F8NF

https://www.amazon.com/Ivermectin-World-Justus-R-Hope/dp/1737415909


https://covid19criticalcare.com/wp-content/uploads/2021/08/SUMMARY-OF-THE-EVIDENCE-BASE.pdf

So you don't need vaccines and you don't need any of the measures that have been introduced at all." See mark 31:15.

https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

For any reader still under the illusion that these mRNA covid vaccines have helped, please read the following article comparing the countries without vaccination to those with it. The most vaccinated nations have deaths per million up to 100 x greater than the least. Always question what the government tells you.


https://www.thedesertreview.com/opi...cle_978543f2-56c2-11ec-af20-5ff179ad7b93.html

Yeadon goes on to explain that people need not worry about variants. He explains that our immune system is easily able to deal with ALL mutations of SARS-CoV-2 and explains that 18 years after the first SARS, those people are still protected by their immunity - and this immunity even extends to immunity against SARS-CoV-2, a virus 80% similar but 20% different than the original SARS.

Yeadon's major point is that if survivors of SARS some 18 years later have immunity against the new virus, which is 20% different, why would we believe that a current viral mutant only 0.3% different would be a threat? See mark 35:40.

https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

"So when your government scientists say that a variant that’s 0.3% different from SARS could masquerade as a new virus and be a threat to your health, you should know, and I'm telling you, THEY ARE LYING. If they're lying and they are, why is the pharmaceutical industry making top-up vaccines? They are making them." See mark 35:55

https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

"You should be terrified at this point. I am, because there is absolutely no possible justification for their manufacture. But they're being made, and the world's medicine regulators have said...we won't be asking them to do any clinical safety studies. Let me just say again, the variants are not different enough to represent a threat to you so you do not need top-up vaccines...


The regulators have waved them through. I'm very frightened of that - there's no possible benign interpretation of this. I believe they are going to be used to damage your health and possibly kill you. Seriously. I can see no sensible interpretation other than a serious attempt at mass depopulation.

This will provide the tools to do it and plausible deniability - because they will create another story about some sort of biological threat, you'll line up and get your top-up vaccines, and a few months or a year or so later, you'll die of some peculiar, inexplicable syndrome, and they won't be able to associate it with the top-up vaccines." See mark 36:05 to 37:15.


-----snip------


https://www.thedesertreview.com/opi...cle_76c6081c-61b8-11ec-ae59-7718e6d063ed.html


5Fw1sjK.jpg




If anyone's interested you can download the complaint from the lawfirm's web-site here: https://hannahroselaw.co.uk/icc-complaint-uk/. It's too large to attach to this message.
 

the_shootist

Checked out! Good luck!
Eagle
Mother Lode
Joined
May 31, 2015
Messages
81,156
Reaction score
181,612

Socrates, Thought Police, Ivermectin and Uttar Pradesh

Part 2 of my response to Mr. Alex Berenson’s personal attack on Fox​

Robert W Malone MD, MS
Jan 16
As many are now aware, Mr. Alex Berenson decided to use a Fox/ Laura Ingraham show segment to launch an unprovoked ad homonym attack on me as committing “clearly a large exaggeration” by referring to myself as “the inventor of the mRNA technology” or by asserting that “Ivermectin has been proven to work”. In his critique, Mr. Berenson – a former NYTimes journalist without any formal medical training, assumes a self-anointed position as speaker on behalf of “those of us who are trying to raise questions about the vaccine”.
The Laura Ingram show segment had intended to focus on Big Tech censorship and the “Open Letter To Spotify” signed by a rag tag collection of 270 pro-censorship malcontents who self-identify as a “coalition of scientists, medical professionals, professors, and science communicators spanning a wide range of fields such as microbiology, immunology, epidemiology, and neuroscience”. This motley group of self-appointed thought police and Academic Nobility accuse “The Joe Rogan Experience” web host Spotify of the following thoughtcrime:
“By allowing the propagation of false and societally harmful assertions, Spotify is enabling its hosted media to damage public trust in scientific research and sow doubt in the credibility of data-driven guidance offered by medical professionals.”
The specific infraction cited is JRE # 1757 , and in particular the brief explanation of the brilliant insights of Dr. Mattias Desmet concerning the Mass Formation process which has repeatedly lead to the madness of crowds across the entire span of recorded history, and which has been accelerated and deepened during the 20th and 21st centuries due to the rise of mass media.
In the open letter, these culture warriors do not actually cite the source as evidence, but rather a derivative character assassination hit job from the notoriously biased “Politifact”. Evidence cited by “Politifact” supporting their character assassination was that Twitter deplatformed me for posting this factual redpill entitled “The Pfizer Inoculations Do More Harm Than Good”.

The current thoughtcrime committed by myself with accomplices Joe Rogan and Spotify is asserted to rise to the level of being a “sociological issue of devastating proportions”, consequent to “predatory medical misinformation”. However, the text also reveals the underlying issue which triggered this ragtag collection of Academic Elite, trainees, and associated camp followers- that being a “backlash and resistance as the public grows to distrust our research and expertise”. According to the authors and signatories, this is a particularly egregious infraction of unwritten California thoughtcrime law due to the fact that “the average age of Joe Rogan Experience listeners is 24 years old”. In other words, I have committed the same thoughtcrime for which Socrates was put to death: corrupting young minds and having no regard for the Academic/Medical/Pharmaceutical-industrial complex gods of the state.
Well, if my crime is that of Socrates, then clearly this self-appointed Dikastes are well within both their self-mandate and historic precedent to demand the modern equivalent of drinking the hemlock; that Spotify “immediately establish a clear and public policy to moderate misinformation on its platform” and cancel the offending podcast episode.
But getting back to the claims of Mr. Alex Berenson, we have previously addressed his baseless assertion of committing “clearly a large exaggeration” by referring to myself as “the inventor of the mRNA technology”. Now lets turn to his ignorant, uninformed regurgitation of Merck , FDA, and legacy media propaganda concerning the lack of efficacy and safety of Ivermectin as a component of modern early staged treatment protocols for COVID-19 disease.
Here’s the inconvenient truth. The Federal Government’s Department of Health and Human Services of the United States of America has developed an atrocious track record during the many waves of COVID-19 disease which have swept across the country. As if it were not bad enough that the evidence implicates Dr. Anthony Fauci and his minions as having created the pathogen SARS-CoV-2 in a biodefense strategy that would make Rube Goldberg’s Professor Butts proud, the United States is listed by Worldometers as having the most deaths attributed to the disease in the entire world.

If adjusted for mortality as a function of population (total cases per 1M population), the US ranks 19th out of 234 nations (2,614 deaths/1 million). In contrast, India comes in at 130 out of 234 with 347 deaths/1 million. The overall world average for deaths/million population is 712.
What public policies are responsible for this amazing difference in outcomes?

The curious case of the Indian state of Uttar Pradesh is often sited. Densely populated, relatively poor, and they have absolutely crushed the COVID-19 death curve. Widespread availability of a package distributed throughout the region, rumored to contain the repurposed drug Ivermectin, have often been credited for this amazing success. But until now, these rumors have remained unsubstantiated. As I mentioned recently on the Fox segment in response to the unprovoked attack by Mr. Berenson, a close colleague of mine recently returned from a vacation in the region. Prompted by my specific request that she seek out evidence of the contents of these “care packages” which have been made available throughout the region, she returned with the following photograph of the list of ingredients. As is often observed, a picture is worth a thousand words.
So, without further ado, I am glad to finally be able to provide photographic evidence of what is responsible for the miracle of Uttar Pradesh. I have nothing more to add, other than that an apology is owed (By Mr. Berenson and many others) to the many brave physicians who have persisted, against enormous coordinated media and governmental pressure, to prescribe this agent as a key component of the staged early treatment protocols responsible for saving countless lives across the USA and the world.
 

Uglytruth

Mother Lode Found
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
22,251
Reaction score
55,452
COMPLY OR ELSE WE RUIN YOU!


Doctor loses license, must have psych evaluation for COVID falsehoods, board says BY JULIA MARNIN JANUARY 14, 2022 5:49 PM Dr. Meryl J. Nass had her license suspended by a licensing board in Maine after accused of sharing COVID-19 misinformation. She must undergo a psych evaluation. CHARLES REX ARBOGAST AP This article has Unlimited Access. For more coverage, sign up for our daily coronavirus newsletter. To support our commitment to public service journalism: Subscribe Now. A doctor with decades of experience can’t practice medicine after her license was temporarily suspended over complaints that she shared coronavirus misinformation, according to a Maine licensing board. The board has ordered her to undergo a neuropsychological evaluation, it said. Dr. Meryl J. Nass, who got a license to practice medicine in Maine in 1997, had her license “immediately” suspended for 30 days after a board investigation and review of complaints against her on Jan. 12, according to a suspension order from the Maine Board of Licensure in Medicine. Nass, who’s an internist in Ellsworth, must “submit” to an evaluation by a “Board-selected psychologist” on Feb. 1, the board’s evaluation order issued Jan. 11 said. “I have no comment about submitting to a neuropsych exam, except that the board ordered me to do so on shaky grounds,” Nass told McClatchy News, adding that she’s had her license for a total of 41 years. $2 for 2 months Subscribe for unlimited access to our website, app, eEdition and more CLAIM OFFER “The information received by the Board demonstrates that Dr. Nass is or may be unable to practice medicine with reasonable skill and safety to her patients by reason of mental illness, alcohol intemperance, excessive use of drugs, narcotics, or as a result of a mental or physical condition interfering with the competent practice of medicine,” the evaluation order states. The complaints against Nass include how the board was told she engaged in “public dissemination of ‘misinformation’” about COVID-19 and vaccinations “via a video interview and on her website,” the board said about the October 26, 2021 complaint. It lists several comments Nass made that were subject to the board’s investigation. Roughly 10 days later, the board got another complaint about Nass “spreading COVID and COVID vaccination misinformation on Twitter,” it said. Nass called “disinformation and misinformation” a “fuzzy concept” that the board hasn’t defined for her, she said. “There’s no law that says doctors can’t express their educated opinion on any subject.” Other grounds for her suspension include how Nass treated COVID-19 patients with Ivermectin and hydroxychloroquine, according to the board.

Read more at: https://www.miamiherald.com/news/coronavirus/article257335847.html#storylink=cpy