• "Spreading the ideas of freedom loving people on matters regarding metals, finance, politics, government and many other topics"

Corona Virus News & Info

Uglytruth

Super Moderator
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
20,590
Reaction score
50,438
I thought he meant those that funded the "research" as in fauci.
 

engineear

Platinum Bling
Midas Supporter
Platinum Bling
Joined
Mar 11, 2011
Messages
6,344
Reaction score
10,321
Location
North of the Wall
Someone may have just blown Moderna up. Others have previously identified non naturally occurring genetic sequences ... Appears one of the human fingerprints inexplicably appears in a Moderna patent filing. I have still never heard Fauci or anyone explain - if not the case - where's the bat?!?! There is/was none.




Amk5wuOtFWxT.jpeg
Those bats were scientists working at Wuhan.
 

Winston_Room101

Silver Miner
Joined
Mar 31, 2010
Messages
623
Reaction score
549
@ CTCCTCGGCGGGCACGTAG
from
is

"
https%3A%2F%2Fbucketeer-e05bbc84-baa3-437e-9518-adb32be77984.s3.amazonaws.com%2Fpublic%2Fimages%2F8f7cb4d1-54b4-481c-b4e9-5011c9f28a95_758x313.png
"

In this particular section you can see it’s a sequence of the “spike protein” (surface glycoprotein) and the nucleotides are labelled 23548…23771 (of about 30,000 nucleotides or bases i.e. G-C-A-T). [NB: in actual fact this is RNA so should have a U in place of every T, but BLAST compensates for this automatically for simplicity]. The smaller number is the number of amino acid in the protein sequence so for each 3 nucleotides, the number goes up by 1 amino acid. The highlight is amino acid 677 (Q) to 686 (S), giving 677→686 = QTNSPRRARS.
Now, this is really interesting because not only have we seen that the QTNS section is derived from HIV but there is something very special about the adjacent PRRAR because that is a furin cleavage site and as we have seen, these don’t exist in this type of SARS-like virus. It’s an insertion to the viral genome, but nobody really knows how it got there (just like the HIV sequences). In order to see where it came from we need to look outside the amino acid sequence and back to the genome sequence.
The genome sequence that you can see for this amino acid sequence is: CAGACTAATTCTCCTCGGCGGGCACGTAGT which is 30 nucleotides coding for 10 amino acids. For this sequence to arise by chance would be an infinitesimally small number, so it has to have arisen somewhere (i.e. from another virus) or else some of it must be synthetic. So let’s BLAST(n) it, and this time we exclude “synthetic constructs” from our search (because we are looking for real viruses, not synthetic ones). What do we get?

and from the comments
Sky Savage
Dec 28, 2021Liked by Dr Ah Kahn Syed
This work should be the subject of a real congressional hearing. The data are damn near irrefutable. As a scientist, I am continually astounded that more scientists are not speaking up about this.

24
Reply


founding
Dr Ah Kahn Syed
Dec 28, 2021
AUTHOR
Correct. The fact that as a PhD I have to hide behind a murine avatar and pseudonym should tell you all you need to know.

24
Reply

and then
ModeRnaTx

Synthetic construct HCV1146 Moderna (mRNA-1273) SARS-CoV-2 vaccine sequence​


JOURNAL Submitted (10-SEP-2021) Department of Clinical Microbiology,
Copenhagen University Hospital Amager-Hvidovre, University of
Copenhagen, Kettegaard Alle 30, Hvidovre 2650, Danmark
REFERENCE 1 (bases 1 to 3828)

3828 / 3 = 1276
 

Joe King

Midas Member
Midas Member
Sr Site Supporter
Joined
Mar 31, 2010
Messages
13,466
Reaction score
17,630
Location
Instant Gratification Land
^^^^ imho, everyone should read that link. Spells it out pretty clearly.
 

Uglytruth

Super Moderator
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
20,590
Reaction score
50,438

Hulk Hogan Slams COVID Narrative, Claims Vaccinated Are “Dropping Like Flies”​

byJill Schrider
January 15, 2022
2 minute read
The Hulkimaniac has come out swinging against the experimental COVID injection, claiming the vaccinated are “dropping like flies” while referring to popular celebrities who have recently passed away.
Screen-Shot-2022-01-14-at-8.54.39-PM-658x1024.png

This isn’t the first time Hulkimania has taken the COVID-craze head-on. Back in 2020, Hogan posted a long-form response to the COVID-inspired government lockdowns where he invoked the name, Jesus Christ.
“Maybe we don’t need a vaccine,” Hogan writes. “Maybe we need to take this time of isolation from the distractions of the world and have a personal revival where we focus on the ONLY thing in the world that really matters. Jesus.”

“Word up, can you handle the truth my brother only love HH In three short months, just like He did with the plagues of Egypt, God has taken away everything we worship. God said, “you want to worship athletes, I will shut down the stadiums. You want to worship musicians, I will shut down Civic Centers. You want to worship actors, I will shut down theaters. You want to worship money, I will shut down the economy and collapse the stock market. You don’t want to go to church and worship Me, I will make it where you can’t go to church”
“If my people who are called by my name will humble themselves and pray and seek my face and turn from their wicked ways, then I will hear from heaven and will forgive their sin and will heal their land.”
Hulk Hogon has since been the target of liberal media outlets and talk show hosts who have all come out against his opinions on the vaccine. This, of course, has had little effect on the 5 times world wrestling champion, as his unwavering love of God keeps the Hulkamaniac in good spirits.

Hulk Hogan is an inspiration and a role model for all, and an exemplary American. The brutish giant has a heart bigger than any politician in the white house, and he isn’t about to let a vaccine stop it.
 

arminius

Argentate Bluster
Eagle
Platinum Bling
Joined
Jun 6, 2011
Messages
7,831
Reaction score
13,374
@ CTCCTCGGCGGGCACGTAG
from
is

So this BLAST is a manufactored poison, not a virus, therefore not infective or spread the way some of ya'all believe viruses are spread. Good thing we have lots of movies to teach us, right.

So therefore what's the easiest way to spread this, and how in the past have poisons been spread to damage populations. Water mainly, but in the last 100 years, secondary to airplanes, air.
 

Casey Jones

Train left the station...
Gold Chaser
Site Supporter ++
Platinum Bling
Joined
Apr 4, 2020
Messages
10,132
Reaction score
16,446
Location
Down the road from the Kaczynski ranch
So this BLAST is a manufactored poison, not a virus, therefore not infective or spread the way some of ya'all believe viruses are spread. Good thing we have lots of movies to teach us, right.

So therefore what's the easiest way to spread this, and how in the past have poisons been spread to damage populations. Water mainly, but in the last 100 years, secondary to airplanes, air.
It didn't occur in nature; so the odds are, it won't survive long in nature. mOronic Variant may be proof of that...as the virus mutates to something more amenable to what environment that successful viruses live in.

But meantime...we've got a veritable army of Doctor-Frankenstein wannabees out there...here and in Wuhan. All excited about making you sick and keeping you sicker.
 

Uglytruth

Super Moderator
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
20,590
Reaction score
50,438

Florida won’t enforce federal health care worker vaccine mandate​

Where does that leave the state’s hospitals and nursing homes?
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493
test
@ CTCCTCGGCGGGCACGTAG
from
is

"
https%3A%2F%2Fbucketeer-e05bbc84-baa3-437e-9518-adb32be77984.s3.amazonaws.com%2Fpublic%2Fimages%2F8f7cb4d1-54b4-481c-b4e9-5011c9f28a95_758x313.png
"





and from the comments


and then
ModeRnaTx

Synthetic construct HCV1146 Moderna (mRNA-1273) SARS-CoV-2 vaccine sequence​





3828 / 3 = 1276

Interesting reader comments also.....

BLAST.jpg
 

Uglytruth

Super Moderator
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
20,590
Reaction score
50,438

POLITICAL Science: HHS Tells Hospitals to Stop Reporting Covid Deaths Ahead of Midterms​

By J.D. Rucker • Jan. 15, 2022

The plummeting fortunes of the Democrat Party have rendered many progressives apoplectic. They don’t understand why the Biden-Harris regime policies aren’t working or why the Democrat majority on Capitol Hill can’t get anything passed. They see their polling numbers and most are beside themselves, masked and terrified of what’s to come.
But some are still fighting. When backed into a corner, Democrats have a tendency to go to extremes to try to maintain power. The latest move by Health and Human Services appears to be the opening volley in a desperate move to salvage the fortunes of the party ahead of the midterm elections.


It’s no coincidence that the documents telling hospitals to stop reporting Covid-19 deaths were dropped on January 6 when many Americans were busy debunking the wild claims of the left that it was an anniversary of an “insurrection” while a few Americans were getting their daily fix of confirmation bias on CNN or MSNBC. Either way, the news was buried while media was busy covering the non-story of the January 6 mostly peaceful protests.


This was by design.

But some people noticed, and now we’re here to make sure more people know about it. Despite the incessant demands by the regime that every man, woman, and child gets vaccinated to “save lives,” they’re taking the opposite approach with recording the numbers. By telling hospitals not to report deaths, their intention is to make a steady drop in Covid statistics that will artificially point to the regime’s “successful” efforts against the pandemic.


It’s all a lie, of course, but did we expect anything less from a regime that claimed the Afghanistan withdrawal was a success and that we’re in the middle of the greatest economy in world history?
 

Ensoniq

Midas Member
Midas Member
Eagle
Joined
Apr 9, 2013
Messages
12,733
Reaction score
29,129
Location
North Carolina

Florida won’t enforce federal health care worker vaccine mandate​

Where does that leave the state’s hospitals and nursing homes?

i see no conflict. As I understand it Florida is not preventing hospitals from following the rule, they just won’t use state resources to enforce Fed rules. Plenty of precedent that the Feds can’t compel states to help them
 

Casey Jones

Train left the station...
Gold Chaser
Site Supporter ++
Platinum Bling
Joined
Apr 4, 2020
Messages
10,132
Reaction score
16,446
Location
Down the road from the Kaczynski ranch

Florida won’t enforce federal health care worker vaccine mandate​

Where does that leave the state’s hospitals and nursing homes?
Probably FedGov will refuse Medicare/Medicaid payments to them.

That's the kind of confrontation that Biden's handlers just LUUUV.
 

RebelYell

Name no longer reflects my changed worldview.
Gold Chaser
Site Supporter
Joined
Apr 2, 2010
Messages
1,808
Reaction score
2,507

We'll See​

================​

Gates, Fauci, and Daszak charged with Genocide in Court Filing​


In a stunning 46-page legal filing to the International Criminal Court on December 6, an intrepid attorney and seven applicants accused Anthony Fauci, Peter Daszak, Melinda Gates, William Gates III, and twelve others of numerous violations of the Nuremberg Code. These included various crimes against humanity and war crimes as defined by the Rome Statutes, Articles 6, 7, 8, 15, 21, and 53.

https://www.riotimesonline.com/braz...ty-in-international-criminal-court-complaint/


https://dailyexpose.uk/2021/12/10/u...-international-criminal-court/comment-page-1/


https://leohohmann.com/2021/12/17/w...-committed-crimes-against-humanity/#more-8418

Besides the four kingpins, twelve others were named, including the CEOs of the leading vaccine corporations and the health leaders held accountable for the United Kingdom.

  • Albert Bourla, CEO of Pfizer
  • Stephane Bancel, CEO of AstraZeneca
  • Pascal Soriot, CEO of Moderna
  • Alex Gorsky, CEO of Johnson and Johnson
  • Tedros Adhanhom Ghebreyesus, Director-General of the WHO
  • Boris Johnson, UK Prime Minister
  • Christopher Whitty, UK Chief Medical Adviser
  • Matthew Hancock, former UK Secretary of State for Health and Social Care
  • Sajid Javid, current UK Secretary of State for Health and Social Care
  • June Raine, UK Chief Executive of Medicines and Healthcare products
  • Dr. Ravid Shah, President of the Rockefeller Foundation
  • Klaus Schwab, President of the World Economic Forum
https://docdro.id/WUjv6iw

Dr. Ravid Shah, having worked for the Gates Foundation since 2001, was named a World Economic Forum “Young Global Leader” in 2007. He now presides over the Rockefeller Foundation, a group funding ID2020 along with the Gates Foundation.

https://norberthaering.de/en/power-control/id2020-immunization-passes/


Klaus Schwab, a wickedly intelligent, perhaps diabolical German with double doctorate degrees in Economics and Engineering, is the founder of the World Economic Forum, a club for the wealthiest percentile of the world’s corporate and political elite. He is a power broker who has groomed many presidents, prime ministers, and tech CEOs who now view him with reverence and unswerving loyalty.

Schwab, an economist, and technocrat has befriended many nations, most significantly China’s Xi Jinping, who delivered a key speech at Davos. He praised his vision of a New World Order. On January 25, 2021, Klaus Schwab vowed his support for Xi Jinping with these words, “Mr. President (Xi Jinping) I believe this is the best time to reset our policies and to work, jointly, for a peaceful and prosperous world. We all welcome now, his excellency, Xi Jinping, President of the People’s Republic of China.” See mark 2:26.


View attachment 237794
61c0bd0b560eb.image.png


Many consider Schwab the mastermind behind the current movement towards cryptocurrency, universal identification, and a one-world (fascist) government to be run jointly, in totalitarian fashion, with China.

https://conservapedia.com/Klaus_Schwab

Attorney Hannah Rose and seven applicants brought the Nuremberg action on behalf of the victims, the entire population of the United Kingdom. She filed the legal proceeding with the International Criminal Court located at The Hague. The Hague is notable for its long history in helping victims seek redress for war crimes and defining appropriate ethical guidelines for conduct during war.

Following the Nazi atrocities committed during World War II, the war crime trials were held in Nuremberg, Germany. Following these, a set of principles was developed, which ultimately led to the development of the Nuremberg Code.

These principles essentially meant that anyone, no matter how wealthy or powerful, even a head of state, was not above the law. The fact that the law of their home nation would permit their action would not relieve the person from justice under international law.

In particular, the medical experiments conducted by the Nazi doctors led to strict rules and ethical principles regarding future human scientific trials, including the doctrine of necessary informed consent and freedom from coercion or threat in submitting to experimental drugs.

As we all know, before receiving a surgical procedure, there is a legal and ethical requirement that the patient be apprised of any significant potential risks, including infection, bleeding, nerve damage, or even death. The patient usually signs the consent form following this explanation. And as we all know, whenever we receive prescription medication, we are notified of the potential risks on a package insert and usually a discussion with the Pharmacist.


The vaccines should be no different, yet they are. A person about to receive the jab is rarely told that there are risks of blood clots, bleeding, cerebral thrombosis, myocarditis, and death, yet those risks exist. See mark 12:58 to 17:40.

https://rumble.com/vg6dcd-peter-mccullough-interview.html

https://ukfreedomproject.org/resources/open-letter-to-dr-june-raine-chief-executive-mhra/

https://www.thedesertreview.com/opi...cle_b1089af2-4279-11ec-b491-5bcaf600d33c.html

https://www.totalhealth.co.uk/blog/are-people-getting-full-facts-covid-vaccine-risks

Attorney Hannah Rose notes in Point 40 of her brief that the ethical standards of the Nuremberg Code amount to an obligation on physicians and pharmaceutical manufacturers to abide by its principles. Accordingly, any physician or research scientist found to have breached any of the ten principles of the Nuremberg Code would face criminal liability.

https://docdro.id/WUjv6iw

She notes in Point 42, “The first principle of the Nuremberg Code is a willingness and informed consent by the person to receive treatment and participate in an experiment. The person is supposed to activate freedom of choice without the intervention, either through force, deceit, fraud, threat, solicitation, or any other type of binding or coercion.”

https://docdro.id/WUjv6iw

In Point 43 she argues, “When the heads of the Ministry of Health as well as the Prime Minister presented the vaccine in the United Kingdom and began the vaccination of United Kingdom residents, the vaccinated were not advised, that in practice, they would be taking part in a medical experiment and that their consent is required under the Nuremberg Code. This as a matter of fact is a genetic medical experiment on human beings performed without informed consent under a severe and blatant offense of the Nuremberg Code.”


In addition, Rose argues under Point 44 that there is an obligation for alternative treatments to be discussed, including the risks and benefits of such alternatives. She notes that these were never discussed despite the fact alternative treatments have been proven to be safe and effective “with up to a 100% success rate.”

https://docdro.id/WUjv6iw

https://www.zerohedge.com/covid-19/indias-ivermectin-blackout-secret-revealed

A key principle of the Nuremberg Code requires that a scientist must be prepared to terminate the experiment at any stage, if he has probable cause to believe, in the exercise of the good faith, superior skill, and careful judgment required of him that a continuation of the experiment is likely to result in injury, disability, or death to the experimental subject.

https://encyclopedia.ushmm.org/cont...emberg-code#permissible-medical-experiments-1

In Point 46, she argues, “It is known that the mRNA ‘vaccination’ treatments have caused the death of many as well as injury and severe damage (including disablement and paralysis) after the ‘vaccine’ was administered. Despite this fact, the government did not instruct the initiation of an investigation into the matter. It is also questionable that given the experimental nature of these vaccinations, that there are not any full reports available of the numbers of dead or injured, as may be expected in such a medical process for the benefit of the public participating in the experiment.”

https://docdro.id/WUjv6iw

The reader is reminded that Nazi physicians conducted experiments on human beings in concentration camps without informed consent, leading to horrific suffering and death.


https://encyclopedia.ushmm.org/content/en/article/nazi-medical-experiments

https://www.pbs.org/wgbh/nova/holocaust/experiside.html

To dramatically underscore the relevance of Nuremberg to the horrific deaths we now see related to the experimental mRNA ‘vaccination’ program, Rose, in Point 34a, included a statement from a group of Holocaust survivors, those who experienced first-hand both the Nazi experiments and today the vaccine experiment. This is an excerpt from their unique perspective:

We, the survivors of the atrocities committed against humanity during the Second World War, feel bound to follow our conscience…Another holocaust of greater magnitude is taking place before our eyes. We call upon you to stop this ungodly medical experiment on humankind immediately. It is a medical experiment to which the Nuremberg Code must be applied.

https://docdro.id/WUjv6iw

Holocaust survivor Vera Sharav issued a statement in Points 34b and 34c:

The stark lesson of the Holocaust is that whenever doctors join forces with government and deviate from their personal, professional, clinical commitment to do no harm to the individual, medicine can then be perverted from a healing, humanitarian profession to a murderous apparatus…What sets the Holocaust apart from all other mass genocides is the pivotal role played by the medical establishment, the entire medical establishment. Every step of the murderous process was endorsed by the academic, professional medical establishment.

https://docdro.id/WUjv6iw

As a direct result of the Nuremberg World War II experience, the United Nations asked the International Law Commission to develop the Nuremberg Principles, the key standards to avoid the Nazi doctors' atrocities. Unfortunately, as Hannah Rose pointed out, many of these ten principles of the Nuremberg Code were systematically violated by the United Kingdom and many other countries during the COVID-19 pandemic.


https://encyclopedia.ushmm.org/cont...emberg-code#permissible-medical-experiments-1

View attachment 237795
61c0bded2c43e.image.png

International Criminal Court
In addition, a permanent international criminal court was established for investigation and enforcement - known as The International Criminal Court. The ICC began full-time operations in 2002 and currently has 123 member nations that have explicitly agreed to be bound by the Rome Statutes.

The United Kingdom is a member while the United States is not. However, under article 12(3) of the Rome Statute of the International Criminal Court, even a state that is NOT a member may exercise jurisdiction "by declaration lodged with the Registrar," meaning that any nation may be subject to the ICC depending upon the circumstances, member nation or not. Keep in mind that Nazi Germany had not consented to jurisdiction.

The ICC bills itself as a "court of last resort" meaning that claims should be decided in the perpetrator's home nation whenever possible. However, the core principle of impunity drives the ICC, the belief that no one who commits war crimes should enjoy freedom from criminal responsibility. Therefore, the ICC operates as an impartial and omnipotent arbiter of world human rights and will aggressively step in when it sees flagrant Nuremberg-type atrocities without consequence.

That is precisely what Hannah Rose has identified in her legal brief in Point 2,

"We have tried to raise this case through the English police and the English Court system without success, we have been unable even to get the case registered either with the police or with the court after several attempts...This is such a case which is why we are addressing the ICC directly."


Attorney Rose relied partly upon the expertise of Dr. Michael Yeadon, a research-based PhD in respiratory pharmacology and former Vice President and Chief Scientist at Pfizer.

https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

In the background section of the brief, she writes in Point 5:

"The Covid-19 ‘vaccines’ do not meet the requirement to be categorized as vaccines and are in fact gene therapy (Appendix 8)...Dr. Mike Yeadon, a joint applicant on this request, asserts that claims calling the Covid-19 injections a 'vaccine' is public manipulation and misrepresentation of clinical treatment.

It's not a vaccination. It's not prohibiting infection. It's not a prohibiting transmission device. It's a means by which your body is conscripted to make the toxin that then allegedly your body somehow gets used to dealing with it, but unlike a vaccine, which is to trigger the immune response, this is to trigger the creation of the toxin.'

MRNA uses the cell's machinery to synthesize proteins that are supposed to resemble the SPIKE protein of the virus, which is what it uses to enter cells via the ACE2 receptor. These proteins are then identified by the immune system, which builds antibodies against them. The real concern is that these proteins could accumulate in the body, especially in regions of high concentration of ACE2 receptors, such as the gonads. If the immune system then attacks the location where they accumulate, then you could be dealing with an auto-immune condition."

https://docdro.id/WUjv6iw

Dr. Yeadon mentions, in an interview, that our governments have grossly exaggerated the entire threat of COVID-19. He notes that COVID-19 represents a slightly greater risk than influenza if you are older than age 70 but a much lower risk than the seasonal flu if you are younger. See mark 31:00.


https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

"So it’s just absurd that you should be happy or willing to let your economy and civil society be smashed for something which represents for almost everyone working a lower risk than influenza - but that’s true.

Given this virus represents at worst a slightly bigger risk to the old and ill than does influenza, and a less risk than for almost everyone else who’s younger and fit, it was NEVER NECESSARY for us to have done anything.

We didn't need to do anything, lockdowns, masks, mass testing, vaccines - there are multiple therapeutic drugs that are at least as effective as vaccines are...an off-patent drug called Ivermectin, one of the most widely used drugs in the world, is also able to reduce symptoms at any stage of the disease including lethality by about 90%.

https://www.amazon.com/Ivermectin-Freedom-Justus-R-Hope-ebook/dp/B09M95F8NF

https://www.amazon.com/Ivermectin-World-Justus-R-Hope/dp/1737415909


https://covid19criticalcare.com/wp-content/uploads/2021/08/SUMMARY-OF-THE-EVIDENCE-BASE.pdf

So you don't need vaccines and you don't need any of the measures that have been introduced at all." See mark 31:15.

https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

For any reader still under the illusion that these mRNA covid vaccines have helped, please read the following article comparing the countries without vaccination to those with it. The most vaccinated nations have deaths per million up to 100 x greater than the least. Always question what the government tells you.


https://www.thedesertreview.com/opi...cle_978543f2-56c2-11ec-af20-5ff179ad7b93.html

Yeadon goes on to explain that people need not worry about variants. He explains that our immune system is easily able to deal with ALL mutations of SARS-CoV-2 and explains that 18 years after the first SARS, those people are still protected by their immunity - and this immunity even extends to immunity against SARS-CoV-2, a virus 80% similar but 20% different than the original SARS.

Yeadon's major point is that if survivors of SARS some 18 years later have immunity against the new virus, which is 20% different, why would we believe that a current viral mutant only 0.3% different would be a threat? See mark 35:40.

https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

"So when your government scientists say that a variant that’s 0.3% different from SARS could masquerade as a new virus and be a threat to your health, you should know, and I'm telling you, THEY ARE LYING. If they're lying and they are, why is the pharmaceutical industry making top-up vaccines? They are making them." See mark 35:55

https://rumble.com/vg4inv-michael-yeadon-full-interview-planet-lockdown.html

"You should be terrified at this point. I am, because there is absolutely no possible justification for their manufacture. But they're being made, and the world's medicine regulators have said...we won't be asking them to do any clinical safety studies. Let me just say again, the variants are not different enough to represent a threat to you so you do not need top-up vaccines...


The regulators have waved them through. I'm very frightened of that - there's no possible benign interpretation of this. I believe they are going to be used to damage your health and possibly kill you. Seriously. I can see no sensible interpretation other than a serious attempt at mass depopulation.

This will provide the tools to do it and plausible deniability - because they will create another story about some sort of biological threat, you'll line up and get your top-up vaccines, and a few months or a year or so later, you'll die of some peculiar, inexplicable syndrome, and they won't be able to associate it with the top-up vaccines." See mark 36:05 to 37:15.


-----snip------


https://www.thedesertreview.com/opi...cle_76c6081c-61b8-11ec-ae59-7718e6d063ed.html


5Fw1sjK.jpg




If anyone's interested you can download the complaint from the lawfirm's web-site here: https://hannahroselaw.co.uk/icc-complaint-uk/. It's too large to attach to this message.
 

the_shootist

Politically Gender Neutral
Eagle
Mother Lode
Joined
May 31, 2015
Messages
81,082
Reaction score
178,199

Socrates, Thought Police, Ivermectin and Uttar Pradesh

Part 2 of my response to Mr. Alex Berenson’s personal attack on Fox​

Robert W Malone MD, MS
Jan 16
As many are now aware, Mr. Alex Berenson decided to use a Fox/ Laura Ingraham show segment to launch an unprovoked ad homonym attack on me as committing “clearly a large exaggeration” by referring to myself as “the inventor of the mRNA technology” or by asserting that “Ivermectin has been proven to work”. In his critique, Mr. Berenson – a former NYTimes journalist without any formal medical training, assumes a self-anointed position as speaker on behalf of “those of us who are trying to raise questions about the vaccine”.
The Laura Ingram show segment had intended to focus on Big Tech censorship and the “Open Letter To Spotify” signed by a rag tag collection of 270 pro-censorship malcontents who self-identify as a “coalition of scientists, medical professionals, professors, and science communicators spanning a wide range of fields such as microbiology, immunology, epidemiology, and neuroscience”. This motley group of self-appointed thought police and Academic Nobility accuse “The Joe Rogan Experience” web host Spotify of the following thoughtcrime:
“By allowing the propagation of false and societally harmful assertions, Spotify is enabling its hosted media to damage public trust in scientific research and sow doubt in the credibility of data-driven guidance offered by medical professionals.”
The specific infraction cited is JRE # 1757 , and in particular the brief explanation of the brilliant insights of Dr. Mattias Desmet concerning the Mass Formation process which has repeatedly lead to the madness of crowds across the entire span of recorded history, and which has been accelerated and deepened during the 20th and 21st centuries due to the rise of mass media.
In the open letter, these culture warriors do not actually cite the source as evidence, but rather a derivative character assassination hit job from the notoriously biased “Politifact”. Evidence cited by “Politifact” supporting their character assassination was that Twitter deplatformed me for posting this factual redpill entitled “The Pfizer Inoculations Do More Harm Than Good”.

The current thoughtcrime committed by myself with accomplices Joe Rogan and Spotify is asserted to rise to the level of being a “sociological issue of devastating proportions”, consequent to “predatory medical misinformation”. However, the text also reveals the underlying issue which triggered this ragtag collection of Academic Elite, trainees, and associated camp followers- that being a “backlash and resistance as the public grows to distrust our research and expertise”. According to the authors and signatories, this is a particularly egregious infraction of unwritten California thoughtcrime law due to the fact that “the average age of Joe Rogan Experience listeners is 24 years old”. In other words, I have committed the same thoughtcrime for which Socrates was put to death: corrupting young minds and having no regard for the Academic/Medical/Pharmaceutical-industrial complex gods of the state.
Well, if my crime is that of Socrates, then clearly this self-appointed Dikastes are well within both their self-mandate and historic precedent to demand the modern equivalent of drinking the hemlock; that Spotify “immediately establish a clear and public policy to moderate misinformation on its platform” and cancel the offending podcast episode.
But getting back to the claims of Mr. Alex Berenson, we have previously addressed his baseless assertion of committing “clearly a large exaggeration” by referring to myself as “the inventor of the mRNA technology”. Now lets turn to his ignorant, uninformed regurgitation of Merck , FDA, and legacy media propaganda concerning the lack of efficacy and safety of Ivermectin as a component of modern early staged treatment protocols for COVID-19 disease.
Here’s the inconvenient truth. The Federal Government’s Department of Health and Human Services of the United States of America has developed an atrocious track record during the many waves of COVID-19 disease which have swept across the country. As if it were not bad enough that the evidence implicates Dr. Anthony Fauci and his minions as having created the pathogen SARS-CoV-2 in a biodefense strategy that would make Rube Goldberg’s Professor Butts proud, the United States is listed by Worldometers as having the most deaths attributed to the disease in the entire world.

If adjusted for mortality as a function of population (total cases per 1M population), the US ranks 19th out of 234 nations (2,614 deaths/1 million). In contrast, India comes in at 130 out of 234 with 347 deaths/1 million. The overall world average for deaths/million population is 712.
What public policies are responsible for this amazing difference in outcomes?

The curious case of the Indian state of Uttar Pradesh is often sited. Densely populated, relatively poor, and they have absolutely crushed the COVID-19 death curve. Widespread availability of a package distributed throughout the region, rumored to contain the repurposed drug Ivermectin, have often been credited for this amazing success. But until now, these rumors have remained unsubstantiated. As I mentioned recently on the Fox segment in response to the unprovoked attack by Mr. Berenson, a close colleague of mine recently returned from a vacation in the region. Prompted by my specific request that she seek out evidence of the contents of these “care packages” which have been made available throughout the region, she returned with the following photograph of the list of ingredients. As is often observed, a picture is worth a thousand words.
So, without further ado, I am glad to finally be able to provide photographic evidence of what is responsible for the miracle of Uttar Pradesh. I have nothing more to add, other than that an apology is owed (By Mr. Berenson and many others) to the many brave physicians who have persisted, against enormous coordinated media and governmental pressure, to prescribe this agent as a key component of the staged early treatment protocols responsible for saving countless lives across the USA and the world.
 

Uglytruth

Super Moderator
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
20,590
Reaction score
50,438
COMPLY OR ELSE WE RUIN YOU!


Doctor loses license, must have psych evaluation for COVID falsehoods, board says BY JULIA MARNIN JANUARY 14, 2022 5:49 PM Dr. Meryl J. Nass had her license suspended by a licensing board in Maine after accused of sharing COVID-19 misinformation. She must undergo a psych evaluation. CHARLES REX ARBOGAST AP This article has Unlimited Access. For more coverage, sign up for our daily coronavirus newsletter. To support our commitment to public service journalism: Subscribe Now. A doctor with decades of experience can’t practice medicine after her license was temporarily suspended over complaints that she shared coronavirus misinformation, according to a Maine licensing board. The board has ordered her to undergo a neuropsychological evaluation, it said. Dr. Meryl J. Nass, who got a license to practice medicine in Maine in 1997, had her license “immediately” suspended for 30 days after a board investigation and review of complaints against her on Jan. 12, according to a suspension order from the Maine Board of Licensure in Medicine. Nass, who’s an internist in Ellsworth, must “submit” to an evaluation by a “Board-selected psychologist” on Feb. 1, the board’s evaluation order issued Jan. 11 said. “I have no comment about submitting to a neuropsych exam, except that the board ordered me to do so on shaky grounds,” Nass told McClatchy News, adding that she’s had her license for a total of 41 years. $2 for 2 months Subscribe for unlimited access to our website, app, eEdition and more CLAIM OFFER “The information received by the Board demonstrates that Dr. Nass is or may be unable to practice medicine with reasonable skill and safety to her patients by reason of mental illness, alcohol intemperance, excessive use of drugs, narcotics, or as a result of a mental or physical condition interfering with the competent practice of medicine,” the evaluation order states. The complaints against Nass include how the board was told she engaged in “public dissemination of ‘misinformation’” about COVID-19 and vaccinations “via a video interview and on her website,” the board said about the October 26, 2021 complaint. It lists several comments Nass made that were subject to the board’s investigation. Roughly 10 days later, the board got another complaint about Nass “spreading COVID and COVID vaccination misinformation on Twitter,” it said. Nass called “disinformation and misinformation” a “fuzzy concept” that the board hasn’t defined for her, she said. “There’s no law that says doctors can’t express their educated opinion on any subject.” Other grounds for her suspension include how Nass treated COVID-19 patients with Ivermectin and hydroxychloroquine, according to the board.

Read more at: https://www.miamiherald.com/news/coronavirus/article257335847.html#storylink=cpy
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493
Are you taking Melatonin?

Melatonin a Promising Candidate for Prevention and Treatment of COVID-19

Melatonin for the Early Treatment of COVID-19: A Narrative Review of Current Evidence and Possible Efficacy
 

Ensoniq

Midas Member
Midas Member
Eagle
Joined
Apr 9, 2013
Messages
12,733
Reaction score
29,129
Location
North Carolina
There are so few experts willing to speak up against the COVID nonsense. It’s disappointing to see them bicker amongst themselves

Let’s focus on the problem

There is enough room on the right side of the issue for Berenson and Dr Malone
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493
A Review of the Science
Exercise and vitamin D3 are beneficial, omicron is mild in children, asymptomatic spread with Omicron is significant
Robert W Malone MD, MS -- Jan 17, 2022
 

Goldhedge

Retired
Sr Midas Sup +++
Survivor
GIM Hall Of Fame
Joined
Mar 28, 2010
Messages
69,514
Reaction score
153,755
Location
Rocky Mountains

Dr. Peter McCullough: Official COVID "Narrative Has Crumbled"​

BY TYLER DURDEN
MONDAY, JAN 17, 2022 - 11:50 PM
Authored by Art Moore via WND.com,

Dr. Peter McCullough – a renowned cardiologist and highly published medical scientist whose confrontation of the government's COVID-19 policies has drawn more than 40 million views on Joe Rogan's podcast – told WND in a video interview Thursday night the official pandemic narrative that has been fiercely guarded by establishment media and social-media censors is "completely crumbling."''

That narrative, he said, included "false statements regarding asymptomatic spread, reliance on lockdown and masks – which obviously didn't work – the suppression of early treatment, the mass promotion of vaccines that failed."


"And now here we are, almost in complete free fall," McCullough said, referring to the record number of COVID-19 cases as officials acknowledge the vaccines don't prevent infection or transmission.

McCullough noted that in California, with the more contagious but much milder omicron variant now dominant, health care workers who tested positive for COVID-19 and had symptoms were told to go back to work.

"With that, I think that's it. I think that's the end. The narrative has crumbled. People don't want these vaccines," McCullough said.
"The vaccines should be pulled off the market. They clearly are not solving the problem."
The focus, he said, should be on "treating high-risk patients who develop symptoms" with some of the early treatments that he and other physicians around the world have found to be effective, including ivermectin and a new drug granted emergency use authorization by the FDA, Paxlovid.

McCullough cited a study from Denmark and data from the U.K.'s health agency showing that the vaccines have zero effectiveness against omicron.

Completing this poll entitles you to WND news updates free of charge. You may opt out at anytime. You also agree to our Privacy Policy and Terms of Use.

"That's not misinformation," he said. "I'm just quoting the data. All of this can be looked up. Fact-checkers can look at it. I know I'll never have any problems with allegations of misinformation, because I just quote the data."
President Biden clearly had McCullough in mind when on Thursday he urged social media companies and media outlets to "please deal with the misinformation and disinformation that's on your shows. It has to stop."

McCullough pointed out his work has been relied upon by courts across the nation, including the U.S. Supreme Court, and he has testified to the U.S. Senate and will be back there later this month.

"I think America knows who is giving them the straight story."
In the half-hour video interview with WND (embedded below), McCullough also discussed:
  • The punishment of physicians who counter the official COVID narrative and use clinically indicated, FDA-approved drugs off-label such as ivermectin to treat COVID-19 patients, including a colleague in Maine whose was ordered to undergo a psychological examination after her license was suspended;
  • His participation in a rally in Washington, D.C., on Jan. 23 protesting vaccine mandates;
  • The Supreme Court's rulings Thursday on vaccine mandates;
  • The possibility that omicron could spell the end of the pandemic, serving as a "universal booster";
  • Data showing that vaccination has backfired, making the pandemic worse in nations with high vaccine intake;
  • The lethality of the mRNA vaccines;
  • His view on Biden's mass testing program;
  • His take on new FDA-approved treatments and his simple, inexpensive, over-the-counter protocol for treating omicron;
  • The unwillingness of so many doctors to "come off the sidelines" and treat patients for COVID-19;
  • The "crisis of competence" among top government health officials;
  • Where to find resources and support for physicians and patients, and for employees confronting mandates.
"I think Americans are going to understand that their individual choice is really what's going to matter in the end," he McCullough told WND in conclusion. "If Americans decide that they're not going to take any boosters or any more vaccines, it doesn't matter how many mandates or how many court decisions that happen. The vaccine program is going to crumble. I think it's just a matter of saying no."

He emphasized that the vaccines are still "research."

"No one can be forced into it," he said of vaccination. "And they're not turning out to be safe or effective. So, if everybody just stands firm and declines the vaccines, I think that will be the quickest way for us to get out of this."

See the WND interview with Dr. Peter McCullough:

video at link below​

McCullough, in a video interview with WND in December, called for a "pivot" from the current policies to early treatment and "compassionate care" for those who have COVID or have suffered vaccine injuries, which have included myocarditis, neurological issues and blood clotting.

"Now is the time for doctors to step up. Now is not a time for rhetoric or harsh statements regarding scientific discourse," he said.

Many of McCullough's 600 peer-reviewed publications have appeared in top-tier journals such as the New England Journal of Medicine, Journal of the American Medical Association and The Lancet. He testified to the U.S. Senate in November 2020 against what he described as the federal government's politicization of health care during the pandemic, curbing or blocking the availability of cheap, effective treatments. In a speech in September, he told of having been stripped of the editorship of a Swiss-based journal after having lost his position with a major health system, "with no explanation and no due process." Baylor University Medical Center fired him in February. And Texas A&M College of Medicine, Texas Christian University and University of North Texas Health Science Center School of Medicine have cut ties with McCullough, accusing him of spreading misinformation.

"I've been stripped of every title that I've ever had in that institution. I've received a threat letter from the American College of Physicians, [and] a threat letter from the American Board," he said in September.

All because of his "lawful" participation "in a topic of public importance."

He said there are "powerful forces at work, far more powerful than we can possibly think of, that are influencing anybody who is in a position of authority."

McCullough is the chief medical adviser for the Truth for Health Foundation, a physician-founded charity that says it is "dedicated to following the Oath of Hippocrates to serve individual patients to the best of our ability and judgement and to uphold the highest standards of medical ethics."

* * *

Last year, America's doctors, nurses and paramedics were celebrated as frontline heroes battling a fearsome new pandemic. Today, under Joe Biden, tens of thousands of these same heroes are denounced as rebels, conspiracy theorists, extremists and potential terrorists. Along with massive numbers of police, firemen, Border Patrol agents, Navy SEALs, pilots, air-traffic controllers, and countless other truly essential Americans, they're all considered so dangerous as to merit termination, their professional and personal lives turned upside down due to their decision not to be injected with the experimental COVID vaccines. Biden’s tyrannical mandate threatens to cripple American society – from law enforcement to airlines to commercial supply chains to hospitals. It's already happening. But the good news is that huge numbers of "yesterday’s heroes" are now fighting back – bravely and boldly. The whole epic showdown is laid out as never before in the sensational October issue of WND's monthly Whistleblower magazine, titled "THE GREAT AMERICAN REBELLION: 'We will not comply!' COVID-19 power grab ignites bold new era of national defiance."

 

TRYNEIN

Gold Member
Gold Chaser
Site Supporter ++
Joined
Sep 16, 2012
Messages
17,150
Reaction score
98,935
Location
third cove on the right
Pepe PureBloodNOVAX©®™
@DoItPepe
8m
"This is an excellent reminder that you and you alone are ultimately responsible for your (and your family's) healthcare decisions."

"The truth is that not all doctors have your best intentions in mind, nor are they necessarily experts in all things medicine. Many have simply been used as a means to enable big pharma to make BIG MONEY (whether they're aware of as much or not)."

"In the end the matter of choices a lawful citizen makes about their own life is theirs alone to make....and it's non-negotiable. At its core the very freedoms we enjoy cannot be taken (or given) away - by threat or intimidation. That's actually the whole damn point."

Our Declaration of Independence even makes the point fairly clearly:

'We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable Rights, that among these are Life, Liberty and the pursuit of Happiness.'

Stand your damn ground.
It's yours.




c292e5495334d9a3.png
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493
He said there are "powerful forces at work, far more powerful than we can possibly think of, that are influencing anybody who is in a position of authority."
And it's world-wide.
We live in interesting times.
 

Goldhedge

Retired
Sr Midas Sup +++
Survivor
GIM Hall Of Fame
Joined
Mar 28, 2010
Messages
69,514
Reaction score
153,755
Location
Rocky Mountains
And it's world-wide.
We live in interesting times.
and it didn't just start yesterday...

“Since I entered politics, I have chiefly had men's views confided to me privately. Some of the biggest men in the United States, in the field of commerce and manufacture, are afraid of something. They know that there is a power somewhere so organized, so subtle, so watchful, so interlocked, so complete, so pervasive, that they better not speak above their breath when they speak in condemnation of it.”​


― Woodrow Wilson, The New Freedom
 

the_shootist

Politically Gender Neutral
Eagle
Mother Lode
Joined
May 31, 2015
Messages
81,082
Reaction score
178,199
and it didn't just start yesterday...

“Since I entered politics, I have chiefly had men's views confided to me privately. Some of the biggest men in the United States, in the field of commerce and manufacture, are afraid of something. They know that there is a power somewhere so organized, so subtle, so watchful, so interlocked, so complete, so pervasive, that they better not speak above their breath when they speak in condemnation of it.”​


― Woodrow Wilson, The New Freedom
Gee, I wonder what tribe old Woody was referring to, even back then
 
Last edited:

Irons

Outlaw Prospector
Survivor
GIM Hall Of Fame
Midas Supporter ++
Joined
Mar 30, 2010
Messages
32,984
Reaction score
68,708

Study, Fourth Shot of COVID Vaccine Ineffective at Preventing Omicron Infection

January 17, 2022 | sundance | 420 Comments

A study out of Israel is showing the fourth shot, second booster of COVID vaccine, provides no benefit in the prevention of the Omicron variant.


fingers-crossed-vaccination.jpg


(Reuters) – A fourth shot of COVID-19 vaccine boosts antibodies to
even higher levels than the third jab but it is not enough to prevent Omicron infections, according to a preliminary study in Israel.

Israel’s Sheba Medical Center has given second booster shots in a trial among its staff and is studying the effect of the Pfizer booster in 154 people after two weeks and the Moderna booster in 120 people after one week, said Gili Regev-Yochay, director of the Infectious Diseases Unit.
[…] “We know by now that the level of antibodies needed to protect and not to get infected from Omicron is probably too high for the vaccine, even if it’s a good vaccine.” (read more)


I’m at a complete loss about why anyone would keep arguing for value in the vaccine passport. If vaccinated and unvaccinated equally are susceptible to COVID infection, and the vaccine does nothing of benefit in that encounter, then why in the heck are vaccine passports even considered of value?



This ain't about health................
 

the_shootist

Politically Gender Neutral
Eagle
Mother Lode
Joined
May 31, 2015
Messages
81,082
Reaction score
178,199

Study, Fourth Shot of COVID Vaccine Ineffective at Preventing Omicron Infection

January 17, 2022 | sundance | 420 Comments

A study out of Israel is showing the fourth shot, second booster of COVID vaccine, provides no benefit in the prevention of the Omicron variant.


fingers-crossed-vaccination.jpg


(Reuters) – A fourth shot of COVID-19 vaccine boosts antibodies to
even higher levels than the third jab but it is not enough to prevent Omicron infections, according to a preliminary study in Israel.

Israel’s Sheba Medical Center has given second booster shots in a trial among its staff and is studying the effect of the Pfizer booster in 154 people after two weeks and the Moderna booster in 120 people after one week, said Gili Regev-Yochay, director of the Infectious Diseases Unit.
[…] “We know by now that the level of antibodies needed to protect and not to get infected from Omicron is probably too high for the vaccine, even if it’s a good vaccine.” (read more)


I’m at a complete loss about why anyone would keep arguing for value in the vaccine passport. If vaccinated and unvaccinated equally are susceptible to COVID infection, and the vaccine does nothing of benefit in that encounter, then why in the heck are vaccine passports even considered of value?



This ain't about health................
The Beat Goes On!
 

Uglytruth

Super Moderator
Sr Midas Sup +++
Survivor
Mother Lode
Joined
Apr 6, 2011
Messages
20,590
Reaction score
50,438

Palm Beach therapist sees increase in children's speech delays during COVID-19​



WPBF

Updated: 7:35 AM EST Nov 9, 2021
Infinite Scroll Enabled
https://www.wpbf.com/news-team/a7634880-b715-48d0-ab05-133563335392
Mark Kelly
Anchor

TRACKING THE COVID-19 VACCINE​

Sign up for daily emails with local updates and other important news.
Your Email Address
SUBMIT
Privacy Notice

PALM BEACH COUNTY, Fla. —
The Centers for Disease Control and Prevention say putting a face mask on your child is a critical tool in slowing the spread of COVID-19, however, some in the health community are now sounding an alarm.
Therapists say they are seeing children with speech delays.

COVID-19 vaccines for kids: How to make appointments
Gregg Santos brings his son, Diego, to speech therapy twice a week.
"He would just ramble, baby ramble," Santos said. "Certain words that are key did not flow, so that began to raise a red flag."
Santos said his son was born perfectly healthy at the start of a pandemic.
"We'd go out and walk around the neighborhood, and there would be no one there...everyone just stayed in," Santos said.
Santos said he believes social isolation and everyone wearing masks lead to Diego's speech delays.
"It bothers me," Santos said. "It bothers me a lot."
"This has been a very challenging year," said Jaclyn Theek, a clinic director and speech-language pathologist at the Speech and Learning Institute in North Palm Beach.
What are long-term COVID-19 complications like for children and adolescents? Here's what experts say
She said that during this pandemic, her speech therapy clinic has seen an enormous shift in the ages of its patients. Before the pandemic, only 5% of patients were babies and toddlers, while today it's soared to 20%. Many parents call it "COVID-delayed."
"We've seen a 364% patient increase in patient referrals of babies and toddlers from pediatricians and parents," Theek said.
When asked if they are children having a difficult time speaking, Theek said they are "speech-delayed."
Babies start learning how to speak by reading lips at as young as 8-months-old. So when lips and faces are covered up by masks, therapists say for some kids, they can work around the mask and still learn to speak perfectly fine. But for others, it can cause speech delays.
"There's no research out there yet saying that this could be causing speech and language delays. But, most definitely, I'm sure it's a factor," Theek said. "It's very important that kids do see your face to learn, so they're watching your mouth."
Previous coverage: How to talk to kids about COVID-19
While holding an orange-colored marker up to her son, Briana Gay asked her child, "Can you say 'orange'? Orange. That was a good try."
Gay is raising five children, but it's her youngest who needs therapy.
"It definitely makes a difference when the world you are growing up in, you can't interact with people and their face. That's super important to babies," Gay said.
Theek said, "We are seeing a lot of things that look like autism. They're not making any word attempts. And not communicating at all with their family."
Researchers will need time to determine whether COVID-19 masks are the official cause of delayed speech. Still, therapists tell parents that early intervention is key — and that's already working for Diego.
"He's going to be totally fine. I think so," Santos said.
Doctors are telling parents to look for these speech milestones in young children:
  • At 12-months-old, toddlers typically say about five to ten words, such as "mama" and "dada."
  • At 18-months-old, most kids can say 25 to 50 words.
  • By 2-years-old, kids should be saying hundreds of words.
The biggest piece of advice, therapists say, is to give your kids your time. When parents are home and the mask is off, turn off the media and instead read to your child, play and sing with them, so they can observe speech.
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493
Is the Pandemic Scheduled to End by March 1?

Free speech is fleeting, this content will disappear in: 42 HOURS:23 MINUTES:39 SECONDS

Pandemic Narrative Undergoes Radical U-Turn
articles.mercola.com/sites/articles/archive/2022/01/19/pandemic-narrative-undergoes-radical-u-turn.aspx

Analysis by Dr. Joseph Mercola -- January 19, 2022



STORY AT-A-GLANCE​

  • In recent days, the pandemic narrative has undergone a remarkable number of U-turns
  • January 9, 2022, CDC director Dr. Rochelle Walensky sent out a tweet saying “We must protect people with comorbidities from severe COVID-19,” in other words, focused protection, which is what tens of thousands of doctors have been calling for since the creation of The Great Barrington Declaration in early October 2020
  • January 10, 2022, Walensky admitted that the COVID shots cannot prevent transmission
  • The CDC is now saying you should not retest once you’ve recovered from COVID, as the PCR can provide false positives for up to 12 weeks after the infection has been resolved. They’re also cutting the isolation requirement from 10 to just five days — probably because the failing economy is hurting Biden’s approval rating so they need people to work
  • The narrative is also changing on what makes for a COVID case and how deaths are counted. Walensky recently admitted about 40% of “COVID patients” tested positive but do not have symptoms and are hospitalized for something else. She has also promised to deliver data on how many people have actually died “from” COVID and how many died “with” it
As noted by Dr. Ron Paul in the January 10, 2022, Liberty Report above, U.S. authorities have suddenly started to change their tune with regard to COVID and the COVID shots.
“The opposition to our position are starting to wake up,” Paul says, as some shreds of truth are actually starting to be acknowledged. The good news, Paul says, is that “Maybe some of the things they’ve been saying are not quite accurate, and maybe what we’ve been saying is closer to the truth, and maybe they’re starting to recognize that.”

CDC Director Now Calls for Focused Protection​

Indeed, in recent days, the U.S. Centers for Disease Control and Prevention has made a remarkable number of U-turns, completely reversing course on several narrative points.
For example, in a January 10, 2022, CNN interview, CDC director Dr. Rochelle Walensky actually admitted that “what [the COVID shots] can’t do anymore is prevent transmission,”1 whereas before, the narrative was that if you get the jab, you have nothing to worry about anymore. In July 2021, President Biden promised that if you get vaccinated, “you’re not going to get COVID.”2 Well, it wasn’t true. Many knew that, but were censored when pointing it out.
A day earlier, January 9, Walensky also sent out a tweet saying “We must protect people with comorbidities from severe COVID-19,” which is what tens of thousands of doctors have been calling for since the creation of The Great Barrington Declaration in early October 2020. It called for focused protection of high-risk individuals, such as the elderly, rather than blanket lockdowns.

It was recently revealed that Dr. Anthony Fauci, director of the National Institutes of Allergy and Infectious Diseases (NIAID) and his former boss, now retired National Institutes of Health (NIH) director Francis Collins, colluded behind the scenes to quash the declaration.3 For whatever reason, Fauci and Collins were hell-bent on pushing economy-destroying lockdowns instead. In an October 8, 2020, email to Fauci, Collins wrote:4,5,6,7
“The proposal from the three fringe epidemiologists who met with the Secretary seems to be getting a lot of attention ... There needs to be a quick and devastating published take down of its premises ...”
“Don’t worry, I got this,” Fauci replied. Later, Fauci sent Collins links to newly published articles refuting the focused protection solution, including an op-ed in Wired magazine, and an article in The Nation, titled “Focused Protection, Herd Immunity and Other Deadly Delusions.”

CDC Follows Political Strategy, Not Science​

Now, all of a sudden, Walensky is onboard with the “deadly delusion” of focused protection. Her about-face would be confusing were it not for the fact that COVID countermeasures were never about protecting the public from a virus. From the start, the pandemic had political goals, and it still does.
The pressure is now on to prove the Biden administration has made some sort of progress with the pandemic. Biden made a lot of promises, none of which have come to fruition, so now the political establishment is scrounging to come up with some plan that can make them look as though they’re getting somewhere.
The problem is that cases are now exploding, when a successful vaccine campaign should have brought the situation under control. So, they now need a way to minimize the number of cases, whereas before, they used every trick in the book to overcount them,8 in order to scare people into complying with COVID restrictions and getting the jab.

New Testing Guidance Aims to Lower Case Rates​

One simple way to cut down cases is to limit testing, and that’s another U-turn we’re now seeing. The CDC is now saying you should not retest once you’ve recovered from COVID. If you test positive, just quarantine for five days and don’t retest to confirm that you’re negative, as the PCR can provide false positives for up to 12 weeks after the infection has been resolved.
Well, we’ve known this for nearly two years already. From the start, experts warned that the PCR cannot be used to diagnose an active infection, as it can pick up RNA from dead, noninfectious viral debris.
Health authorities are now spinning the tale that these revisions in guidance are because we have two years’ worth of data, and they’re just following the science. But that’s pure baloney, seeing how the data never supported their COVID restrictions in the first place.
The CDC’s decision to revise quarantine guidelines down from 10 days to just five days also appears politically motivated. Polls show the economy is a primary concern of voting Americans right now, so they need to strike a balance between the desired demolition of the economy and keeping people at work — at least until the 2022 elections are over.
There seems to be a LOT of sudden momentum surging in the direction of ending the pandemic. If I’m right, we’re going to see even more of this, and pretty quickly, since Biden has to wrap it up in time to declare victory on March 1. ~ Jeff Childers
In short, I suspect most if not all of the recent changes in COVID guidance is to build a narrative that the Biden administration has successfully brought the pandemic under control and reestablished a working economy. The change in narrative is based on political strategy, not science.

CDC Highlights Role of Comorbidities in Vaxxed COVID Deaths​

rochelle walensky
As noted by Paul in the Liberty Report above, Walensky recently stated that 75% of COVID deaths had four or more comorbidities, “So, really, these are people who were unwell to begin with.” The admission went viral and was cited as proof that COVID is a lethal risk for none but the sickest among us.
The CDC quickly stepped in, clarifying that she meant “75% of COVID deaths among those who have received the COVID jab,” not COVID deaths overall.9 You can see the unedited segment above, where that context is made clear. Still, we know that COVID poses very little risk for healthy unvaccinated people as well, and that comorbidities are a primary risk factor regardless of your COVID jab status.

COVID Death Risk Has Always Been Low — Vaxxed or Not​

For example, a 2020 study10 found 88% of hospitalized COVID patients in New York City had two or more comorbidities, 6.3% had one underlying health condition and 6.1% had none.
In late August 2020, the CDC published data showing only 6% of the total death count had COVID-19 listed as the sole cause of death. The remaining 94% had had an average of 2.6 comorbidities or preexisting health conditions that contributed to their deaths.11 So, yes, COVID is a lethal risk only for the sickest among us, just as Walensky said, but that’s true whether you’re “vaccinated” or not.
As for the study12 Walensky discussed in that “Good Morning America” segment, it found that of the 1.2 million COVID jabbed subjects, only 0.0033% died of COVID between December 2020 and October 2021. (And of those, 77.8% had four or more comorbidities.) This study, Walensky claims as evidence that the COVID shot works wonders to reduce the risk of death.
But does it really? Recall studies13 showing the noninstitutionalized infection fatality rate is on average just 0.26% to begin with, and people under the age of 40 have only a 0.01% risk of dying from COVID.14
When we’re talking about a fraction of a percentage point risk, we’re talking about a risk that is close to statistical zero. So, does lowering your risk of death from 0.01% to 0.003% really translate into something worthwhile? And, more importantly, is that reduction worth the risks involved with taking the jab?
Clearly, it’s not a risk-free decision. OneAmerica, a national mutual life insurance company, recently warned that all-cause deaths among working age Americans (18 to 64) are up 40% over prepandemic norms,15 and they cannot be attributed to COVID.
So, what’s causing these deaths? What potentially deadly thing did tens of millions of Americans do in 2021 that they’ve never done before? I’ll let you ponder whether Walensky’s claim that the COVID jab is saving lives is an accurate one.

CDC Admits Large Portion of ‘COVID Patients’ Aren’t​

In another recent media appearance, Walensky stated that:16
“In some hospitals that we've talked to, up to 40% of the patients who are coming in with COVID-19 are coming in not because they’re sick with COVID, but because they’re coming in with something else and have had ... COVID or the Omicron variant detected.”
This, again, is something that we’ve been highlighting since the start of the pandemic. Most so-called “COVID patients” simply weren’t, and still aren’t. They’re hospitalized for something else entirely, and just happen to get a positive test result upon admission — which very possibly is a false positive. Either way, voila, they’re a COVID patient, even though they’re hospitalized for a broken leg or a heart attack.
As noted by Delta News TV, “Comments like these have cast doubt on the severity of the current COVID surge even as the Supreme Court considers legal challenges to Biden’s sweeping private sector mandates on that very issue.”17

Is the Political Pandemic in Its Final Death Throes?​

In a January 10, 2022, blog post,18 Jeff Childers, an attorney, and the president and founder of Childers Law firm, presents a hypothesis for why we might be looking at the end of the pandemic, as the Biden administration has “no reasonable alternative but to wrap this whole thing up in the next 60 days or so.”
“There’s an interesting political dynamic shaping up, a kind of political vice grip that might just be driving federal COVID policy toward authenticity and an end to the pandemic ... a lot of reality has been breaking through lately,” Childers writes.19
He points out how a federal judge recently ordered the U.S. Food and Drug Administration to release all the Pfizer COVID jab data that the agency wanted 75 years to release. The bulk of that data is now due March 1, 2022, the day of Biden’s State of the Union address. Childers suspects the Pfizer documents will contain plenty of counternarrative fodder and politically embarrassing details.

Why We’re Seeing a U-Turn in the Narrative Now​

Biden needs some good news by his State of the Union address, as it’ll be his last chance to “help move the needle back toward blue,” and the way he can do that is by declaring the pandemic over. He can then claim to be the great liberator who ended the pandemic measures for good.
“If they handle this right, they can give their voting base and sycophantic media agents all the necessary talking points to boost Dem prospects for the midterm elections,” Childers writes.20
But to pull off that U-turn with any semblance of credibility, they have to start cutting the case rate now, and that’s precisely what we’re seeing. For example, the CDC recently changed its guidelines so you don’t need to retest after you’ve recovered from COVID, so no more false positives from recovered people.
Florida’s official policy is now to only test high-risk individuals and those who are symptomatic. Childers points out that the left-leaning Sun Sentinel even ran an article highlighting the fact that despite surging case rates, Florida has the lowest COVID death rate in the nation, second only to the sparsely populated Alaska. “What incredibly powerful force could make the Sun Sentinel downplay the pandemic like this?” he asks.

Will We Finally Get a More Accurate Death Count?​

The CDC also appears poised to change the definition of COVID death to what it should have been all along. Childers notes:
“Fox News ... Bret Baier ... asked [Walensky] ‘how many of the 836,000 deaths in the U.S. linked to COVID are FROM COVID or how many are WITH COVID?’
Director Walensky said ... ‘those data will be forthcoming.’ Until about 10 minutes ago, the CDC said it didn’t HAVE any way to track that kind of information ... But now, apparently, CDC plans to release information about deaths from and with. What do you want to bet they’ll be REDUCING total COVID deaths shortly? By a lot.”
They’re also starting to accurately count only those who are actually sick with COVID rather than including people hospitalized for other reasons who just happen to test positive.
“Yesterday, New York Governor Hochul announced that almost HALF of patients are hospitalized for ‘non-COVID reasons,’ scattering the rotting corpse of the Narrative.
You might recall that just last week she ordered hospitals to start breaking down the reported figures and showing how many folks ACTUALLY are sick with COVID versus just testing positive in the hospital. We’ve been yelling about overcounting hospitalizations for two years now and they just noticed?”21

Same Narrative Switch Seen in Europe​

The same sudden switch in narrative can be seen in Europe. Childers continues:22
“Yesterday, the Guardian UK ran a story headlined, ‘End mass jabs and live with COVID, says ex-head of vaccine taskforce.’ It says Dr. Clive Dix — former chairman of the UK’s vaccine taskforce — has called for a ‘major rethink’ of the UK’s COVID strategy, in effect reversing the approach of the past two years and returning to a ‘new normality.’
Shocking the cores the oft-maligned authors of the Great Barrington Declaration, Dr. Dix — without getting cancelled — said this:
‘We need to analyze whether we use the current booster campaign to ensure the vulnerable are protected, if this is seen to be necessary ... Mass population-based vaccination in the UK should now end.’ Ending mass vaccinations? Suddenly that idea is okay to discuss in the corporate media? Wow.”
In a January 3, 2022, interview with the Daily Telegraph, professor Andrew Pollard, head of the U.K.’s Committee on Vaccination and Immunization who helped create the Oxford-AstraZeneca shot, also made a previously verboten statement: “We can’t vaccinate the planet every four or six months,” he said. “It’s not sustainable or affordable.”23 And, like Dix, Pollard was not canceled, censored or deplatformed.
January 11, 2022, Bloomberg also reported that “European Union regulators warned that frequent COVID-19 booster shots could adversely affect the immune response and may not be feasible. Repeat booster doses every four months could eventually weaken the immune response and tire out people, according to the European Medicines Agency.”24
Marco Cavaleri, the EMA’s head of vaccines strategy, said during a January 11, 2022, press briefing:25
“While use of additional boosters can be part of contingency plans, repeated vaccinations within short intervals would not represent a sustainable long-term strategy. [Boosters] can be done once, or maybe twice, but it’s not something that we can think should be repeated constantly. We need to think about how we can transition from the current pandemic setting to a more endemic setting.”
That same day, the World Health Organization’s Technical Advisory Group on COVID-19 Vaccine Composition (TAG-CO-VAC) also issued a statement26 saying that “a vaccination strategy based on repeated booster doses of the original vaccine composition is unlikely to be appropriate or sustainable.”
They also stated that COVID vaccines that actually prevent infection and transmission need to be developed. The timing of all these statements is nothing if not remarkable. It shows just how coordinated this plandemic narrative is, all around the world.

Justice Sotomayor Called Out​

Perhaps the best example that the narrative is undergoing a radical overhaul, Childers says, is Supreme Court Justice Sonia Sotomayor being fact checked and called out as a liar by The Washington Post:
“You’ll recall that Sotomayor confidently told the lawyers during oral argument Friday that ‘100,000’ children were in critical care and on ventilators with Omicron. The lawyers didn’t challenge her even though there aren’t that many total ICU beds in the whole country.
But on Saturday — the next day! — the Washington Post ran an article headlined, ‘Sotomayor’s false claim that ‘over 100,000’ children are in ‘serious condition’ with COVID.’ FALSE CLAIM?? What?? Here’s how the fact-checking article ended:
‘It’s important for Supreme Court justices to make rulings based on correct data … But Sotomayor during an oral argument offered a figure — 100,000 children in ‘serious condition … many on ventilators’ — that is absurdly high. She earns Four Pinocchios.’ It might be unprecedented for a major liberal newspaper to call out a liberal Justice. What could be going on? ...
There seems to be a LOT of sudden momentum surging in the direction of ending the pandemic. If I’m right, we’re going to see even more of this, and pretty quickly, since Biden has to wrap it up in time to declare victory on March 1. Which would explain why they pushed the SOTU back a month. They need the time to get the pandemic wrapped up.”27
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493
Is the Pandemic Scheduled to End by March 1?

Free speech is fleeting, this content will disappear in: 42 HOURS:23 MINUTES:39 SECONDS

Pandemic Narrative Undergoes Radical U-Turn
articles.mercola.com/sites/articles/archive/2022/01/19/pandemic-narrative-undergoes-radical-u-turn.aspx

Analysis by Dr. Joseph Mercola -- January 19, 2022



STORY AT-A-GLANCE​

  • In recent days, the pandemic narrative has undergone a remarkable number of U-turns
  • January 9, 2022, CDC director Dr. Rochelle Walensky sent out a tweet saying “We must protect people with comorbidities from severe COVID-19,” in other words, focused protection, which is what tens of thousands of doctors have been calling for since the creation of The Great Barrington Declaration in early October 2020
  • January 10, 2022, Walensky admitted that the COVID shots cannot prevent transmission
  • The CDC is now saying you should not retest once you’ve recovered from COVID, as the PCR can provide false positives for up to 12 weeks after the infection has been resolved. They’re also cutting the isolation requirement from 10 to just five days — probably because the failing economy is hurting Biden’s approval rating so they need people to work
  • The narrative is also changing on what makes for a COVID case and how deaths are counted. Walensky recently admitted about 40% of “COVID patients” tested positive but do not have symptoms and are hospitalized for something else. She has also promised to deliver data on how many people have actually died “from” COVID and how many died “with” it
As noted by Dr. Ron Paul in the January 10, 2022, Liberty Report above, U.S. authorities have suddenly started to change their tune with regard to COVID and the COVID shots.
“The opposition to our position are starting to wake up,” Paul says, as some shreds of truth are actually starting to be acknowledged. The good news, Paul says, is that “Maybe some of the things they’ve been saying are not quite accurate, and maybe what we’ve been saying is closer to the truth, and maybe they’re starting to recognize that.”

CDC Director Now Calls for Focused Protection​

Indeed, in recent days, the U.S. Centers for Disease Control and Prevention has made a remarkable number of U-turns, completely reversing course on several narrative points.
For example, in a January 10, 2022, CNN interview, CDC director Dr. Rochelle Walensky actually admitted that “what [the COVID shots] can’t do anymore is prevent transmission,”1 whereas before, the narrative was that if you get the jab, you have nothing to worry about anymore. In July 2021, President Biden promised that if you get vaccinated, “you’re not going to get COVID.”2 Well, it wasn’t true. Many knew that, but were censored when pointing it out.
A day earlier, January 9, Walensky also sent out a tweet saying “We must protect people with comorbidities from severe COVID-19,” which is what tens of thousands of doctors have been calling for since the creation of The Great Barrington Declaration in early October 2020. It called for focused protection of high-risk individuals, such as the elderly, rather than blanket lockdowns.

It was recently revealed that Dr. Anthony Fauci, director of the National Institutes of Allergy and Infectious Diseases (NIAID) and his former boss, now retired National Institutes of Health (NIH) director Francis Collins, colluded behind the scenes to quash the declaration.3 For whatever reason, Fauci and Collins were hell-bent on pushing economy-destroying lockdowns instead. In an October 8, 2020, email to Fauci, Collins wrote:4,5,6,7

“Don’t worry, I got this,” Fauci replied. Later, Fauci sent Collins links to newly published articles refuting the focused protection solution, including an op-ed in Wired magazine, and an article in The Nation, titled “Focused Protection, Herd Immunity and Other Deadly Delusions.”

CDC Follows Political Strategy, Not Science​

Now, all of a sudden, Walensky is onboard with the “deadly delusion” of focused protection. Her about-face would be confusing were it not for the fact that COVID countermeasures were never about protecting the public from a virus. From the start, the pandemic had political goals, and it still does.
The pressure is now on to prove the Biden administration has made some sort of progress with the pandemic. Biden made a lot of promises, none of which have come to fruition, so now the political establishment is scrounging to come up with some plan that can make them look as though they’re getting somewhere.
The problem is that cases are now exploding, when a successful vaccine campaign should have brought the situation under control. So, they now need a way to minimize the number of cases, whereas before, they used every trick in the book to overcount them,8 in order to scare people into complying with COVID restrictions and getting the jab.

New Testing Guidance Aims to Lower Case Rates​

One simple way to cut down cases is to limit testing, and that’s another U-turn we’re now seeing. The CDC is now saying you should not retest once you’ve recovered from COVID. If you test positive, just quarantine for five days and don’t retest to confirm that you’re negative, as the PCR can provide false positives for up to 12 weeks after the infection has been resolved.
Well, we’ve known this for nearly two years already. From the start, experts warned that the PCR cannot be used to diagnose an active infection, as it can pick up RNA from dead, noninfectious viral debris.
Health authorities are now spinning the tale that these revisions in guidance are because we have two years’ worth of data, and they’re just following the science. But that’s pure baloney, seeing how the data never supported their COVID restrictions in the first place.
The CDC’s decision to revise quarantine guidelines down from 10 days to just five days also appears politically motivated. Polls show the economy is a primary concern of voting Americans right now, so they need to strike a balance between the desired demolition of the economy and keeping people at work — at least until the 2022 elections are over.
There seems to be a LOT of sudden momentum surging in the direction of ending the pandemic. If I’m right, we’re going to see even more of this, and pretty quickly, since Biden has to wrap it up in time to declare victory on March 1. ~ Jeff Childers
In short, I suspect most if not all of the recent changes in COVID guidance is to build a narrative that the Biden administration has successfully brought the pandemic under control and reestablished a working economy. The change in narrative is based on political strategy, not science.

CDC Highlights Role of Comorbidities in Vaxxed COVID Deaths​

rochelle walensky
As noted by Paul in the Liberty Report above, Walensky recently stated that 75% of COVID deaths had four or more comorbidities, “So, really, these are people who were unwell to begin with.” The admission went viral and was cited as proof that COVID is a lethal risk for none but the sickest among us.
The CDC quickly stepped in, clarifying that she meant “75% of COVID deaths among those who have received the COVID jab,” not COVID deaths overall.9 You can see the unedited segment above, where that context is made clear. Still, we know that COVID poses very little risk for healthy unvaccinated people as well, and that comorbidities are a primary risk factor regardless of your COVID jab status.

COVID Death Risk Has Always Been Low — Vaxxed or Not​

For example, a 2020 study10 found 88% of hospitalized COVID patients in New York City had two or more comorbidities, 6.3% had one underlying health condition and 6.1% had none.
In late August 2020, the CDC published data showing only 6% of the total death count had COVID-19 listed as the sole cause of death. The remaining 94% had had an average of 2.6 comorbidities or preexisting health conditions that contributed to their deaths.11 So, yes, COVID is a lethal risk only for the sickest among us, just as Walensky said, but that’s true whether you’re “vaccinated” or not.
As for the study12 Walensky discussed in that “Good Morning America” segment, it found that of the 1.2 million COVID jabbed subjects, only 0.0033% died of COVID between December 2020 and October 2021. (And of those, 77.8% had four or more comorbidities.) This study, Walensky claims as evidence that the COVID shot works wonders to reduce the risk of death.
But does it really? Recall studies13 showing the noninstitutionalized infection fatality rate is on average just 0.26% to begin with, and people under the age of 40 have only a 0.01% risk of dying from COVID.14
When we’re talking about a fraction of a percentage point risk, we’re talking about a risk that is close to statistical zero. So, does lowering your risk of death from 0.01% to 0.003% really translate into something worthwhile? And, more importantly, is that reduction worth the risks involved with taking the jab?
Clearly, it’s not a risk-free decision. OneAmerica, a national mutual life insurance company, recently warned that all-cause deaths among working age Americans (18 to 64) are up 40% over prepandemic norms,15 and they cannot be attributed to COVID.
So, what’s causing these deaths? What potentially deadly thing did tens of millions of Americans do in 2021 that they’ve never done before? I’ll let you ponder whether Walensky’s claim that the COVID jab is saving lives is an accurate one.

CDC Admits Large Portion of ‘COVID Patients’ Aren’t​

In another recent media appearance, Walensky stated that:16

This, again, is something that we’ve been highlighting since the start of the pandemic. Most so-called “COVID patients” simply weren’t, and still aren’t. They’re hospitalized for something else entirely, and just happen to get a positive test result upon admission — which very possibly is a false positive. Either way, voila, they’re a COVID patient, even though they’re hospitalized for a broken leg or a heart attack.
As noted by Delta News TV, “Comments like these have cast doubt on the severity of the current COVID surge even as the Supreme Court considers legal challenges to Biden’s sweeping private sector mandates on that very issue.”17

Is the Political Pandemic in Its Final Death Throes?​

In a January 10, 2022, blog post,18 Jeff Childers, an attorney, and the president and founder of Childers Law firm, presents a hypothesis for why we might be looking at the end of the pandemic, as the Biden administration has “no reasonable alternative but to wrap this whole thing up in the next 60 days or so.”

He points out how a federal judge recently ordered the U.S. Food and Drug Administration to release all the Pfizer COVID jab data that the agency wanted 75 years to release. The bulk of that data is now due March 1, 2022, the day of Biden’s State of the Union address. Childers suspects the Pfizer documents will contain plenty of counternarrative fodder and politically embarrassing details.

Why We’re Seeing a U-Turn in the Narrative Now​

Biden needs some good news by his State of the Union address, as it’ll be his last chance to “help move the needle back toward blue,” and the way he can do that is by declaring the pandemic over. He can then claim to be the great liberator who ended the pandemic measures for good.

But to pull off that U-turn with any semblance of credibility, they have to start cutting the case rate now, and that’s precisely what we’re seeing. For example, the CDC recently changed its guidelines so you don’t need to retest after you’ve recovered from COVID, so no more false positives from recovered people.
Florida’s official policy is now to only test high-risk individuals and those who are symptomatic. Childers points out that the left-leaning Sun Sentinel even ran an article highlighting the fact that despite surging case rates, Florida has the lowest COVID death rate in the nation, second only to the sparsely populated Alaska. “What incredibly powerful force could make the Sun Sentinel downplay the pandemic like this?” he asks.

Will We Finally Get a More Accurate Death Count?​

The CDC also appears poised to change the definition of COVID death to what it should have been all along. Childers notes:


They’re also starting to accurately count only those who are actually sick with COVID rather than including people hospitalized for other reasons who just happen to test positive.


Same Narrative Switch Seen in Europe​

The same sudden switch in narrative can be seen in Europe. Childers continues:22



In a January 3, 2022, interview with the Daily Telegraph, professor Andrew Pollard, head of the U.K.’s Committee on Vaccination and Immunization who helped create the Oxford-AstraZeneca shot, also made a previously verboten statement: “We can’t vaccinate the planet every four or six months,” he said. “It’s not sustainable or affordable.”23 And, like Dix, Pollard was not canceled, censored or deplatformed.
January 11, 2022, Bloomberg also reported that “European Union regulators warned that frequent COVID-19 booster shots could adversely affect the immune response and may not be feasible. Repeat booster doses every four months could eventually weaken the immune response and tire out people, according to the European Medicines Agency.”24
Marco Cavaleri, the EMA’s head of vaccines strategy, said during a January 11, 2022, press briefing:25

That same day, the World Health Organization’s Technical Advisory Group on COVID-19 Vaccine Composition (TAG-CO-VAC) also issued a statement26 saying that “a vaccination strategy based on repeated booster doses of the original vaccine composition is unlikely to be appropriate or sustainable.”
They also stated that COVID vaccines that actually prevent infection and transmission need to be developed. The timing of all these statements is nothing if not remarkable. It shows just how coordinated this plandemic narrative is, all around the world.

Justice Sotomayor Called Out​

Perhaps the best example that the narrative is undergoing a radical overhaul, Childers says, is Supreme Court Justice Sonia Sotomayor being fact checked and called out as a liar by The Washington Post:
EnglandEnds.jpg


 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493

Casey Jones

Train left the station...
Gold Chaser
Site Supporter ++
Platinum Bling
Joined
Apr 4, 2020
Messages
10,132
Reaction score
16,446
Location
Down the road from the Kaczynski ranch
The Plandemic is going to end, soon.

So I think. Clif High suggested that; and IMHO, it makes sense.

pResident Pantload is losing it. I mean, he can no longer even fake being anything other than a drooling vegetable. In twenty years, Gates' people would have holograms which could take Pantload's place; but we're not there, yet.

So this means, either Kameltoe or Cankles, if The Powers That Be can get the giggling Indian whore out of the picture. They need a CLEAN SLATE, since the Plandemic didn't work as they wanted.

So, the first step is to wind down the contrived emergency.
 

Casey Jones

Train left the station...
Gold Chaser
Site Supporter ++
Platinum Bling
Joined
Apr 4, 2020
Messages
10,132
Reaction score
16,446
Location
Down the road from the Kaczynski ranch
Me, I think the "powerful forces" are good old-fashioned filthy lucre.

Soros money waved in front of government officials. Government money waved in front of science-whores, people with no integrity who put their credentials and positions up for sale.
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493
The Narrative is Crumbling - 16 Reasons Why (17 min 17 sec):


Published on Jan 15, 2022 by AwakenWithJP​
 

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493

SongSungAU

Mother Lode Found
Sr Site Supporter
Mother Lode
Joined
Jun 8, 2010
Messages
13,795
Reaction score
30,493
Why Good People OBEY Harmful Mandates (7 min 19 sec):


Published on Jan 17, 2022 by AwakenWithJP​